L antigen family, member 3 (LAGE3) - coding DNA reference sequence

(used for variant description)

(last modified February 6, 2023)

This file was created to facilitate the description of sequence variants on transcript NM_006014.3 in the LAGE3 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NC_000023.10, covering LAGE3 transcript NM_006014.3.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
                     .         .         .         .                g.5042
                   ggcgaccacggtgtcttcaaaagccccgtcagggttggcttc       c.-301

 .         .         .         .         .         .                g.5102
 ctggggccggaccgactgtgggtcagtttgcaccagcgctctggaatcgagttacgcgcg       c.-241

 .         .         .         .         .         .                g.5162
 aaagggcagagtttctggaggaaaccgcagcctctcaaccgctgaccgggtctcagaagg       c.-181

 .         .         .         .         .         .                g.5222
 cccccggcagggccgcttggcgggaactgaccacgcgccagtcaggctctccagggacct       c.-121

 .         .         .         .         .         .                g.5282
 gcgcaggcgcgtgtgggcggagtcgtgcgcagggggcggggcttcgggaaggagccacag       c.-61

 .         .         .         .         .         .                g.5342
 agagggcggggcgtaggacctgcgcttcgggggtggagtcggagcggcgcggcggcggtc       c.-1

          .         .         .         .         .         .       g.5402
 ATGCGGGACGCGGATGCAGACGCAGGCGGAGGCGCTGACGGCGGGGATGGCCGGGGTGGC       c.60
 M  R  D  A  D  A  D  A  G  G  G  A  D  G  G  D  G  R  G  G         p.20

          .         .         .         .         .         .       g.5462
 CACAGCTGCCGCGGGGGCGTGGACACAGCCGCAGCTCCGGCCGGTGGAGCTCCCCCAGCG       c.120
 H  S  C  R  G  G  V  D  T  A  A  A  P  A  G  G  A  P  P  A         p.40

          .         .         .         .         .         .       g.5522
 CACGCGCCAGGTCCGGGCAGAGACGCCGCGTCTGCGGCCAGGGGGTCACGAATGCGGCCG       c.180
 H  A  P  G  P  G  R  D  A  A  S  A  A  R  G  S  R  M  R  P         p.60

          | 02         .         .         .         .         .    g.5898
 CACATATT | CACCCTCAGCGTGCCTTTCCCGACCCCCTTGGAGGCGGAAATCGCCCATGGG    c.240
 H  I  F  |  T  L  S  V  P  F  P  T  P  L  E  A  E  I  A  H  G      p.80

          .         .         .         .         .         .       g.5958
 TCCCTGGCACCAGATGCCGAGCCCCACCAAAGGGTGGTTGGGAAGGATCTCACAGTGAGT       c.300
 S  L  A  P  D  A  E  P  H  Q  R  V  V  G  K  D  L  T  V  S         p.100

          .        | 03.         .         .         .         .    g.6242
 GGCAGGATCCTGGTCGT | CCGCTGGAAAGCTGAAGACTGTCGCCTGCTCCGAATTTCCGTC    c.360
 G  R  I  L  V  V  |  R  W  K  A  E  D  C  R  L  L  R  I  S  V      p.120

          .         .         .         .         .         .       g.6302
 ATCAACTTTCTTGACCAGCTTTCCCTGGTGGTGCGGACCATGCAGCGCTTTGGGCCCCCC       c.420
 I  N  F  L  D  Q  L  S  L  V  V  R  T  M  Q  R  F  G  P  P         p.140

          .                                                         g.6314
 GTTTCCCGCTAA                                                       c.432
 V  S  R  X                                                         p.143

          .         .         .         .         .         .       g.6374
 gcctggcctgggcaaatggagcgaggtcccactttgcgtctccttgtaggcagtgcgtcc       c.*60

          .         .         .         .         .         .       g.6434
 atccttccctagggcaggaattcccacagttgctactttcctgggagggcctcatgtttt       c.*120

          .         .         .         .         .         .       g.6494
 atctggttcttaaatgtttgttactacagaaaataaaactgcgctactattccaagtctg       c.*180

          .         .         .         .         .         .       g.6554
 agtttatttgcagctggggcacctcccaatattcttgttgtgcttgggttgctggggggg       c.*240

          .         .         .         .         .         .       g.6614
 ggttctagaattcagatattcaaggagtacaaggaaattgaagacaatttaggaaatgga       c.*300

          .         .         .         .         .         .       g.6674
 agaaaatgaaaatcaattgggttctgtcattcaggattaactactgtcaacattttggaa       c.*360

          .         .         .         .         .         .       g.6734
 tacttcctcagttttacagttgcacttacatagtaaatgtgtaactgtaatatacaccac       c.*420

          .         .         .         .         .         .       g.6794
 ataatatttgcaagtttagtgttaaatttttttcctgatttttaaatctaacatgagctt       c.*480

          .         .         .         .         .         .       g.6854
 ttttcctctaacgatcagtgaagaaagtgctggggcaattgactagtgtctggggcaagg       c.*540

          .         .         .         .         .         .       g.6914
 agttggctccctggaaaatacagtgtctccagccttagggctcttttatagattctatca       c.*600

          .         .         .         .         .         .       g.6974
 gattttctgagagtgaaaaggaagaggtacaactgcttttattctcagaaaacaaggaaa       c.*660

          .         .         .         .         .         .       g.7034
 tggtttgatccttttgagtcttgctttgaagatgtgctgtgtgggaccagagcagctctt       c.*720

          .         .         .         .         .         .       g.7094
 aactgtaggcttgtttccctctatggaggcaacaaacaccattctgggcaccctggccag       c.*780

          .         .         .         .         .         .       g.7154
 tgctgcctaggtgaacatgagcttctctatcctggtgggtggggacagctgctagtccct       c.*840

          .         .         .         .         .         .       g.7214
 gtcctgcttgcacactggagttaccgttcatcctctcctgctggggtgatggccttccct       c.*900

          .         .         .         .         .         .       g.7274
 ggtcttgggtagcttcctcacacgcctgtgctcaccagtagtcgtagtccgctgcacact       c.*960

          .         .         .         .         .         .       g.7334
 ggaacgggagcctctgtggatatccagggttctttccctgtgcagctctcttctctctgg       c.*1020

          .         .                                               g.7356
 ttctccgccctgcaaactccag                                             c.*1042

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The L antigen family, member 3 protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.