lysosomal-associated membrane protein 2 (LAMP2) - coding DNA reference sequence

(used for variant description)

(last modified November 26, 2020)


This file was created to facilitate the description of sequence variants on transcript NM_001122606.1 in the LAMP2 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_007995.1, covering LAMP2 transcript NM_001122606.1.


Please note that introns are available by clicking on the exon numbers above the sequence.
 (upstream sequence)
 .         .         .         .         .         .                g.5060
 aagaaagagccccgcccctagtcttatgactcgcactgaagcgccgattcctggcttttg       c.-121

 .         .         .         .         .         .                g.5120
 caaggctgtggtcggtggtcatcagtgctcttgacccaggtccagcgagccttttccctg       c.-61

 .         .         .         .         .         .                g.5180
 gtgttgcagctgttgttgtaccgccgccgtcgccgccgtcgccgcctgctctgcggggtc       c.-1

          .         .         .         .         .         .       g.5240
 ATGGTGTGCTTCCGCCTCTTCCCGGTTCCGGGCTCAGGGCTCGTTCTGGTCTGCCTAGTC       c.60
 M  V  C  F  R  L  F  P  V  P  G  S  G  L  V  L  V  C  L  V         p.20

      | 02   .         .         .         .         .         .    g.17636
 CTGG | GAGCTGTGCGGTCTTATGCATTGGAACTTAATTTGACAGATTCAGAAAATGCCACT    c.120
 L  G |   A  V  R  S  Y  A  L  E  L  N  L  T  D  S  E  N  A  T      p.40

          .         .         .         .         .         .       g.17696
 TGCCTTTATGCAAAATGGCAGATGAATTTCACAGTACGCTATGAAACTACAAATAAAACT       c.180
 C  L  Y  A  K  W  Q  M  N  F  T  V  R  Y  E  T  T  N  K  T         p.60

     | 03    .         .         .         .         .         .    g.18836
 TAT | AAAACTGTAACCATTTCAGACCATGGCACTGTGACATATAATGGAAGCATTTGTGGG    c.240
 Y   | K  T  V  T  I  S  D  H  G  T  V  T  Y  N  G  S  I  C  G      p.80

          .         .         .         .         .         .       g.18896
 GATGATCAGAATGGTCCCAAAATAGCAGTGCAGTTCGGACCTGGCTTTTCCTGGATTGCG       c.300
 D  D  Q  N  G  P  K  I  A  V  Q  F  G  P  G  F  S  W  I  A         p.100

          .         .         .         .         .         .       g.18956
 AATTTTACCAAGGCAGCATCTACTTATTCAATTGACAGCGTCTCATTTTCCTACAACACT       c.360
 N  F  T  K  A  A  S  T  Y  S  I  D  S  V  S  F  S  Y  N  T         p.120

          .         .         .        | 04.         .         .    g.25244
 GGTGATAACACAACATTTCCTGATGCTGAAGATAAAG | GAATTCTTACTGTTGATGAACTT    c.420
 G  D  N  T  T  F  P  D  A  E  D  K  G |   I  L  T  V  D  E  L      p.140

          .         .         .         .         .         .       g.25304
 TTGGCCATCAGAATTCCATTGAATGACCTTTTTAGATGCAATAGTTTATCAACTTTGGAA       c.480
 L  A  I  R  I  P  L  N  D  L  F  R  C  N  S  L  S  T  L  E         p.160

          .         .         .         .         .         .       g.25364
 AAGAATGATGTTGTCCAACACTACTGGGATGTTCTTGTACAAGCTTTTGTCCAAAATGGC       c.540
 K  N  D  V  V  Q  H  Y  W  D  V  L  V  Q  A  F  V  Q  N  G         p.180

          .       | 05 .         .         .         .         .    g.26368
 ACAGTGAGCACAAATG | AGTTCCTGTGTGATAAAGACAAAACTTCAACAGTGGCACCCACC    c.600
 T  V  S  T  N  E |   F  L  C  D  K  D  K  T  S  T  V  A  P  T      p.200

          .         .         .         .         .         .       g.26428
 ATACACACCACTGTGCCATCTCCTACTACAACACCTACTCCAAAGGAAAAACCAGAAGCT       c.660
 I  H  T  T  V  P  S  P  T  T  T  P  T  P  K  E  K  P  E  A         p.220

          .         .         .         .         .         .       g.26488
 GGAACCTATTCAGTTAATAATGGCAATGATACTTGTCTGCTGGCTACCATGGGGCTGCAG       c.720
 G  T  Y  S  V  N  N  G  N  D  T  C  L  L  A  T  M  G  L  Q         p.240

          .         .  | 06      .         .         .         .    g.27961
 CTGAACATCACTCAGGATAAG | GTTGCTTCAGTTATTAACATCAACCCCAATACAACTCAC    c.780
 L  N  I  T  Q  D  K   | V  A  S  V  I  N  I  N  P  N  T  T  H      p.260

          .         .         .         .         .         .       g.28021
 TCCACAGGCAGCTGCCGTTCTCACACTGCTCTACTTAGACTCAATAGCAGCACCATTAAG       c.840
 S  T  G  S  C  R  S  H  T  A  L  L  R  L  N  S  S  T  I  K         p.280

          .         .     | 07   .         .         .         .    g.31723
 TATCTAGACTTTGTCTTTGCTGTG | AAAAATGAAAACCGATTTTATCTGAAGGAAGTGAAC    c.900
 Y  L  D  F  V  F  A  V   | K  N  E  N  R  F  Y  L  K  E  V  N      p.300

          .         .         | 08         .         .         .    g.32487
 ATCAGCATGTATTTGGTTAATGGCTCCG | TTTTCAGCATTGCAAATAACAATCTCAGCTAC    c.960
 I  S  M  Y  L  V  N  G  S  V |   F  S  I  A  N  N  N  L  S  Y      p.320

          .         .         .         .         .         .       g.32547
 TGGGATGCCCCCCTGGGAAGTTCTTATATGTGCAACAAAGAGCAGACTGTTTCAGTGTCT       c.1020
 W  D  A  P  L  G  S  S  Y  M  C  N  K  E  Q  T  V  S  V  S         p.340

          .         .         .         .         .         .       g.32607
 GGAGCATTTCAGATAAATACCTTTGATCTAAGGGTTCAGCCTTTCAATGTGACACAAGGA       c.1080
 G  A  F  Q  I  N  T  F  D  L  R  V  Q  P  F  N  V  T  Q  G         p.360

          .    | 09    .         .         .         .         .    g.45770
 AAGTATTCTACAG | CTGAAGAATGTTCTGCTGACTCTGACCTCAACTTTCTTATTCCTGTT    c.1140
 K  Y  S  T  A |   E  E  C  S  A  D  S  D  L  N  F  L  I  P  V      p.380

          .         .         .         .         .         .       g.45830
 GCAGTGGGTGTGGCCTTGGGCTTCCTTATAATTGTTGTCTTTATCTCTTATATGATTGGA       c.1200
 A  V  G  V  A  L  G  F  L  I  I  V  V  F  I  S  Y  M  I  G         p.400

          .         .         .                                     g.45866
 AGAAGGAAAAGTCGTACTGGTTATCAGTCTGTGTAA                               c.1236
 R  R  K  S  R  T  G  Y  Q  S  V  X                                 p.411

          .         .         .         .         .         .       g.45926
 tcagttaaatctagtgtttgtttgtttttttcaattagaagttacgtttccattggctaa       c.*60

          .         .         .         .         .         .       g.45986
 aagccaggacatgctgtgcaatagattgtttaagatatgcagactaacttcagtgagttc       c.*120

          .         .         .         .         .         .       g.46046
 ctagctaacttgggcatgagtacacttatttaagacaaaatatattaggaccaatttttt       c.*180

          .         .         .         .         .         .       g.46106
 tctgttttttttcttcctttgttaaagtataattaaaagaaaaattgtggcttagaattt       c.*240

          .         .         .         .         .         .       g.46166
 tttaagtaaataatgattttaagcccctggatccaattatgaaagcatttttgctgatgt       c.*300

          .         .         .         .         .         .       g.46226
 gtaattttatatgttacagttacttatattttactactttgatgttatttgcaaaatcaa       c.*360

          .         .         .         .         .         .       g.46286
 aggtgttaaagaatttaacttgcttcaggaaataaattcaagaacatagtggattcattt       c.*420

          .         .         .         .         .         .       g.46346
 tcattggtggcagacacgaaatttggttcatgataagacttcctttccccacctcctgat       c.*480

          .         .         .         .         .         .       g.46406
 cagcattatttaaatctgtatttttctgttagttaagaaagaaatggcttcatgatattg       c.*540

          .         .         .         .         .         .       g.46466
 tatttaatagcaaaagtttggctgtcttcttcattactgttaatagctactatattttaa       c.*600

          .         .         .         .         .         .       g.46526
 caaggagatttctttttttgttgttgttgttctagagtttggaatatactgattatctca       c.*660

          .         .         .         .         .         .       g.46586
 gacttgacatttatactgaaggatgaagtaagacctccagctttttttaaaaaaggtgtt       c.*720

          .         .         .         .         .         .       g.46646
 gatttggaacacctgtatgggttatggtttattaaggttatggtttagaaagtttttttc       c.*780

          .         .         .         .         .         .       g.46706
 cctcagagccttaacttgttaagaaggttcatttatcctgcactgaaaacaaaaactcta       c.*840

          .         .         .         .         .         .       g.46766
 tatactttgtttgtgtgcctcctgcactctcccattccctatgtgaatatgctctagttg       c.*900

          .         .         .         .         .         .       g.46826
 atatttttaatatattgatttcttttttctcacagcaacaagtgcttactctagaggtta       c.*960

          .         .         .         .         .         .       g.46886
 gtgggccctgatatgtcatcagtcagatgcctgcctagccaaagctggactaagattatt       c.*1020

          .         .         .         .         .         .       g.46946
 ctgtacatttgttgatcttgatatagacttatatccctgtagggactgctaatggctccg       c.*1080

          .         .         .         .         .         .       g.47006
 gcttctggagtaaggtactggagaccactcatccctgtgtctgcttgattggttcagctg       c.*1140

          .         .         .         .         .         .       g.47066
 ttgaattgcccttttatttggaagcagtgttgaagttgtctagggttcaaatggctgctt       c.*1200

          .         .         .         .         .         .       g.47126
 tgtacacctgtcattagtataaggcagatgtttattttatcaagctattttatctctaca       c.*1260

          .         .         .         .         .         .       g.47186
 tttaactaaaaacaaaagttcccaaagatctgccttcacttcagaaattttttttggatt       c.*1320

          .         .         .         .         .         .       g.47246
 aaaaaaattaagcctgaaccttaaataaagtgagttggttattcattccaaggattaagt       c.*1380

          .         .         .         .         .         .       g.47306
 cccaatctacctctcagcacaatgcagaagctcaccactgtattgctgccattaactcat       c.*1440

          .         .         .         .         .         .       g.47366
 gccagaaccctttgccaataactggaattacaaatttttgttaaagaaaatttatcaaga       c.*1500

          .         .         .         .         .         .       g.47426
 tctttctttactgccttctctatatgtacatctcaaaaacatgtacatctcaaaaactgg       c.*1560

          .         .         .         .         .         .       g.47486
 agtagaaagttagattgctcaactacaactcctctagaactctatagctctgacatacag       c.*1620

          .         .         .         .         .         .       g.47546
 attcacactctcctctatttgctaagtatgtaaagaatgttttcttttaaaatgttctct       c.*1680

          .         .         .         .         .         .       g.47606
 tttgagaacaactgcttatttgttataaaagcatttggttaaaatgatgtcatcataaaa       c.*1740

          .         .         .         .         .         .       g.47666
 aacagtggctttgtttcaatacatatttttgagatgattatctagaagccagattaataa       c.*1800

          .         .         .         .         .         .       g.47726
 aatcagcttgtgaccttgctaagcatataaactggaaattcagatacattcaaaattatg       c.*1860

          .         .         .         .         .         .       g.47786
 ggttcatttaaaagtgttctaccttttgggtatgagactaatatcactaattcctcaata       c.*1920

          .         .         .         .         .         .       g.47846
 gttatcatggctctatcttaattaattagaaaatatgtgtgtttaattctttgagaatta       c.*1980

          .         .         .         .         .         .       g.47906
 aaatagagaatattaacagagggttaaaaactgcttcaactccaataagataaaggaagc       c.*2040

          .         .         .         .         .         .       g.47966
 tcaaaatctatgagctgagtgttcaattagctttgcctactgagttcaattttatgtcaa       c.*2100

          .         .         .         .         .         .       g.48026
 tacaacagtggatcagacagtacgactttgaactggtgaatgtaaacaattgtttttcac       c.*2160

          .         .         .         .         .         .       g.48086
 ctaagctgctttggaagaactgatgcttgctgctaactaaagttttggatgtatcgattt       c.*2220

          .         .         .         .         .         .       g.48146
 agagaaccaattaatacctgcaaaataaagcatactgtggtacttctgtttgatctagta       c.*2280

          .         .         .         .         .                 g.48202
 tgtgtgattttagattgatggattaaaaattaataaagatcatacattccatacca           c.*2336

 (downstream sequence)
Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The Lysosomal-associated membrane protein 2 protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.

Powered by LOVD v.3.0 Build 25b
©2004-2020 Leiden University Medical Center