LAS1-like (S. cerevisiae) (LAS1L) - coding DNA reference sequence

(used for variant description)

(last modified October 14, 2018)


This file was created to facilitate the description of sequence variants on transcript NM_031206.4 in the LAS1L gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_016369.1, covering LAS1L transcript NM_031206.4.


Please note that introns are available by clicking on the exon numbers above the sequence.
 (upstream sequence)
                               .         .         .                g.5031
                              gctggtgcggtggcggttcggagtgagggta       c.-61

 .         .         .         .         .         .                g.5091
 gcacgctgagctgaaggctgtgcggagcggcgcggcacagagcctgttgttgagctcagt       c.-1

          .         .         .         .         .         .       g.5151
 ATGTCGTGGGAATCCGGGGCCGGGCCAGGTCTAGGTTCCCAGGGGATGGATCTCGTGTGG       c.60
 M  S  W  E  S  G  A  G  P  G  L  G  S  Q  G  M  D  L  V  W         p.20

          .         .         .         .         .         .       g.5211
 AGTGCGTGGTACGGAAAGTGCGTTAAAGGGAAAGGGTCGTTGCCACTCTCGGCCCACGGC       c.120
 S  A  W  Y  G  K  C  V  K  G  K  G  S  L  P  L  S  A  H  G         p.40

          .         .         .         .         .         .       g.5271
 ATCGTGGTCGCCTGGCTCAGCAGGGCCGAGTGGGACCAGGTGACGGTTTATCTGTTCTGT       c.180
 I  V  V  A  W  L  S  R  A  E  W  D  Q  V  T  V  Y  L  F  C         p.60

          .         .         .         .         .       | 02 .    g.6075
 GACGACCATAAGTTGCAGCGGTACGCGCTTAACCGCATCACGGTGTGGAGGAGCAG | GTCA    c.240
 D  D  H  K  L  Q  R  Y  A  L  N  R  I  T  V  W  R  S  R  |  S      p.80

          .         .         .         .         .         .       g.6135
 GGCAACGAACTCCCTCTGGCAGTGGCTTCTACTGCTGACCTGATACGCTGTAAGCTCTTG       c.300
 G  N  E  L  P  L  A  V  A  S  T  A  D  L  I  R  C  K  L  L         p.100

          .         .         .         .         .         .       g.6195
 GATGTAACTGGTGGCTTGGGCACTGATGAACTTAGACTGCTCTATGGCATGGCATTGGTC       c.360
 D  V  T  G  G  L  G  T  D  E  L  R  L  L  Y  G  M  A  L  V         p.120

    | 03     .         .         .         .         .         .    g.7234
 AG | GTTTGTGAATCTTATCTCAGAGAGGAAGACAAAGTTTGCCAAGGTCCCCCTCAAGTGT    c.420
 R  |  F  V  N  L  I  S  E  R  K  T  K  F  A  K  V  P  L  K  C      p.140

          .   | 04     .         .         .         .         .    g.8416
 CTGGCTCAAGAG | GTAAATATTCCGGATTGGATTGTTGACCTTCGCCATGAGTTGACCCAC    c.480
 L  A  Q  E   | V  N  I  P  D  W  I  V  D  L  R  H  E  L  T  H      p.160

          .         .         .     | 05   .         .         .    g.9954
 AAGAAAATGCCCCATATAAATGACTGCCGCAGAG | GCTGCTACTTTGTCCTGGATTGGCTC    c.540
 K  K  M  P  H  I  N  D  C  R  R  G |   C  Y  F  V  L  D  W  L      p.180

          .         .         .         .         .         .       g.10014
 CAGAAGACCTATTGGTGCCGCCAACTGGAGAACAGCCTGAGAGAGACCTGGGAGTTGGAG       c.600
 Q  K  T  Y  W  C  R  Q  L  E  N  S  L  R  E  T  W  E  L  E         p.200

          .         .         .         .         .         .       g.10074
 GAGTTCAGGGAAGGGATAGAGGAAGAGGATCAAGAGGAAGATAAGAACATTGTTGTTGAT       c.660
 E  F  R  E  G  I  E  E  E  D  Q  E  E  D  K  N  I  V  V  D         p.220

          .         .         .         .         .         .       g.10134
 GACATCACAGAACAGAAACCAGAGCCTCAGGATGATGGGAAAAGTACGGAGTCAGATGTA       c.720
 D  I  T  E  Q  K  P  E  P  Q  D  D  G  K  S  T  E  S  D  V         p.240

          .         .         .         .         .         .       g.10194
 AAGGCCGATGGAGACAGCAAAGGCAGCGAAGAGGTGGATTCTCATTGCAAAAAGGCCCTG       c.780
 K  A  D  G  D  S  K  G  S  E  E  V  D  S  H  C  K  K  A  L         p.260

          .          | 06        .         .         .         .    g.10589
 AGTCATAAAGAGCTATATG | AAAGAGCCCGAGAACTGCTGGTATCATACGAAGAGGAGCAG    c.840
 S  H  K  E  L  Y  E |   R  A  R  E  L  L  V  S  Y  E  E  E  Q      p.280

        | 07 .         .         .         .         .         .    g.11491
 TTTACG | GTGCTGGAGAAATTTAGGTATTTACCTAAGGCCATTAAGGCGTGGAATAACCCG    c.900
 F  T   | V  L  E  K  F  R  Y  L  P  K  A  I  K  A  W  N  N  P      p.300

          .         .         .         .         .       | 08 .    g.14760
 TCCCCACGTGTAGAATGTGTCCTGGCAGAGCTCAAGGGCGTTACATGCGAGAACAG | GGAG    c.960
 S  P  R  V  E  C  V  L  A  E  L  K  G  V  T  C  E  N  R  |  E      p.320

          .         .         .         .         .         .       g.14820
 GCTGTGCTGGATGCTTTTCTGGATGATGGCTTCCTTGTCCCCACATTTGAACAGTTGGCA       c.1020
 A  V  L  D  A  F  L  D  D  G  F  L  V  P  T  F  E  Q  L  A         p.340

          .         .   | 09     .         .         .         .    g.15230
 GCTTTGCAGATAGAATATGAAG | ATGGTCAGACTGAGGTCCAGAGAGGGGAAGGTACTGAC    c.1080
 A  L  Q  I  E  Y  E  D |   G  Q  T  E  V  Q  R  G  E  G  T  D      p.360

          .    | 10    .         .         .         .         .    g.15591
 CCAAAGTCACACA | AAAACGTGGACTTGAATGACGTCCTGGTGCCAAAGCCGTTCTCTCAG    c.1140
 P  K  S  H  K |   N  V  D  L  N  D  V  L  V  P  K  P  F  S  Q      p.380

          .         .         .         .         .         .       g.15651
 TTCTGGCAGCCCCTGCTCAGGGGCCTGCACTCCCAGAACTTCACGCAGGCCCTATTGGAG       c.1200
 F  W  Q  P  L  L  R  G  L  H  S  Q  N  F  T  Q  A  L  L  E         p.400

          .         .         .         .         .         .       g.15711
 AGGATGCTCTCTGAACTGCCAGCCTTGGGGATCAGCGGGATCCGGCCTACCTACATCCTC       c.1260
 R  M  L  S  E  L  P  A  L  G  I  S  G  I  R  P  T  Y  I  L         p.420

          .         .         .         . | 11       .         .    g.16119
 AGATGGACCGTTGAACTGATCGTGGCCAACACCAAGACTG | GACGGAATGCTCGCCGATTT    c.1320
 R  W  T  V  E  L  I  V  A  N  T  K  T  G |   R  N  A  R  R  F      p.440

          .         .         .         .         .         .       g.16179
 TCTGCAGGCCAGTGGGAAGCAAGAAGGGGCTGGAGGCTGTTCAACTGCTCCGCCTCCCTT       c.1380
 S  A  G  Q  W  E  A  R  R  G  W  R  L  F  N  C  S  A  S  L         p.460

          .         .         .         .         .         .       g.16239
 GACTGGCCCCGGATGGTTGAGTCCTGCTTGGGCTCACCTTGCTGGGCCAGCCCCCAACTC       c.1440
 D  W  P  R  M  V  E  S  C  L  G  S  P  C  W  A  S  P  Q  L         p.480

          | 12         .         .         .         .         .    g.21393
 CTTCGGAT | CATCTTCAAAGCCATGGGGCAGGGCCTGCCAGACGAGGAGCAGGAGAAGCTG    c.1500
 L  R  I  |  I  F  K  A  M  G  Q  G  L  P  D  E  E  Q  E  K  L      p.500

          .         .         .         .         .         .       g.21453
 CTGCGCATCTGTTCCATTTATACCCAGAGTGGAGAAAACAGCCTGGTGCAGGAGGGCTCT       c.1560
 L  R  I  C  S  I  Y  T  Q  S  G  E  N  S  L  V  Q  E  G  S         p.520

          .         .         .         .         .         .       g.21513
 GAGGCCTCCCCCATTGGGAAGTCTCCATATACACTAGACAGCCTGTATTGGAGCGTCAAG       c.1620
 E  A  S  P  I  G  K  S  P  Y  T  L  D  S  L  Y  W  S  V  K         p.540

          .         .         .         .         .         .       g.21573
 CCAGCCAGCTCCAGCTTCGGGTCTGAAGCAAAGGCCCAGCAACAGGAGGAGCAGGGCAGT       c.1680
 P  A  S  S  S  F  G  S  E  A  K  A  Q  Q  Q  E  E  Q  G  S         p.560

          .         .         .         .         .         .       g.21633
 GTTAATGATGTCAAGGAAGAGGAGAAGGAGGAGAAAGAGGTCTTGCCAGACCAGGTAGAG       c.1740
 V  N  D  V  K  E  E  E  K  E  E  K  E  V  L  P  D  Q  V  E         p.580

          .         .         .         .         .         .       g.21693
 GAGGAGGAAGAAAATGATGACCAAGAGGAGGAAGAGGAGGATGAAGATGATGAAGATGAT       c.1800
 E  E  E  E  N  D  D  Q  E  E  E  E  E  D  E  D  D  E  D  D         p.600

          .         .         .         .         .         .       g.21753
 GAAGAGGAAGACAGAATGGAGGTGGGGCCTTTCTCTACAGGGCAAGAGTCCCCCACTGCC       c.1860
 E  E  E  D  R  M  E  V  G  P  F  S  T  G  Q  E  S  P  T  A         p.620

          .         .         .         .         .         .       g.21813
 GAGAATGCTAGGCTTCTGGCCCAGAAAAGAGGAGCTTTGCAGGGCTCTGCATGGCAGGTT       c.1920
 E  N  A  R  L  L  A  Q  K  R  G  A  L  Q  G  S  A  W  Q  V         p.640

         | 13.         .         .         .         .         .    g.24886
 AGCTCAG | AAGACGTGCGATGGGACACATTTCCCCTAGGCCGAATGCCAGGTCAGACCGAG    c.1980
 S  S  E |   D  V  R  W  D  T  F  P  L  G  R  M  P  G  Q  T  E      p.660

          .         .         .         .         .         .       g.24946
 GACCCAGCAGAGCTCATGCTGGAGAATTATGACACCATGTATCTTTTGGACCAGCCTGTG       c.2040
 D  P  A  E  L  M  L  E  N  Y  D  T  M  Y  L  L  D  Q  P  V         p.680

          .         .         .         | 14         .         .    g.26927
 CTAGAGCAGCGGCTGGAACCCTCAACATGCAAGACTGA | CACCTTGGGCCTGAGCTGTGGT    c.2100
 L  E  Q  R  L  E  P  S  T  C  K  T  D  |  T  L  G  L  S  C  G      p.700

          .         .         .         .         .         .       g.26987
 GTCGGCAGTGGCAACTGCAGCAACAGCAGCAGCAGCAACTTCGAGGGCCTTCTCTGGAGC       c.2160
 V  G  S  G  N  C  S  N  S  S  S  S  N  F  E  G  L  L  W  S         p.720

          .         .         .         .                           g.27032
 CAGGGGCAGCTGCATGGGCTCAAAACTGGCCTGCAGCTCTTCTGA                      c.2205
 Q  G  Q  L  H  G  L  K  T  G  L  Q  L  F  X                        p.734

          .         .         .         .         .         .       g.27092
 tggccatccctggtgcaagtgttcatccagccgtgccagggcaacagcccaccccctagt       c.*60

          .         .         .         .         .         .       g.27152
 acaactgatgctccctgagacaacctgggagacagcctggatcagccacatcaactcagt       c.*120

          .         .         .         .         .         .       g.27212
 tgtccaccacaggggaattttgaatgtcttttgtttttgttttgttttgaaaaataataa       c.*180

          .                                                         g.27225
 acaggcaactgta                                                      c.*193

 (downstream sequence)
Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The LAS1-like (S. cerevisiae) protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.

Powered by LOVD v.3.0 Build 21
©2004-2018 Leiden University Medical Center