linker for activation of T cells (LAT) - 246 nt intron 03 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.6123
gtgagtacaaggagggtcccctaccttgggtgccagggagagggtcccctggtgtgggag  c.163+60

         .         .         .         .         .         .  g.6183
tgagcgtgaaccttcagacttcccctgccaccttggggctgcccacatggccttgacctg  c.163+120

     g.6186
agc  c.163+123

--------------------- middle of intron ---------------------
                                              g.6187          g.6189
                                              c.164-123  tgg  c.164-121

.         .         .         .         .         .           g.6249
gagaggggagatggctcccccaggcctgtccagggtgtggggctttcaggggcttagtct  c.164-61

.         .         .         .         .         .           g.6309
gttctttgaggccttgacgatgtccggagtccttctttcaacttggttctgtgtcctcag  c.164-1


Powered by LOVD v.3.0 Build 27
©2004-2022 Leiden University Medical Center