lecithin-cholesterol acyltransferase (LCAT) - coding DNA reference sequence

(used for variant description)

(last modified November 9, 2017)


This file was created to facilitate the description of sequence variants on transcript NM_000229.1 in the LCAT gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_009778.1, covering LCAT transcript NM_000229.1.


Please note that introns are available by clicking on the exon numbers above the sequence.
 (upstream sequence)
                                                   .                g.5011
                                                  ccagggctgga       c.-1

          .         .         .         .         .         .       g.5071
 ATGGGGCCGCCCGGCTCCCCATGGCAGTGGGTGACGCTGCTGCTGGGGCTGCTGCTCCCT       c.60
 M  G  P  P  G  S  P  W  Q  W  V  T  L  L  L  G  L  L  L  P         p.20

          .         .         .         .         .         .       g.5131
 CCTGCCGCCCCCTTCTGGCTCCTCAATGTGCTCTTCCCCCCGCACACCACGCCCAAGGCT       c.120
 P  A  A  P  F  W  L  L  N  V  L  F  P  P  H  T  T  P  K  A         p.40

          .         .         .     | 02   .         .         .    g.5926
 GAGCTCAGTAACCACACACGGCCCGTCATCCTCG | TGCCCGGCTGCCTGGGGAATCAGCTA    c.180
 E  L  S  N  H  T  R  P  V  I  L  V |   P  G  C  L  G  N  Q  L      p.60

          .         .         .         .         .         .       g.5986
 GAAGCCAAGCTGGACAAACCAGATGTGGTGAACTGGATGTGCTACCGCAAGACAGAGGAC       c.240
 E  A  K  L  D  K  P  D  V  V  N  W  M  C  Y  R  K  T  E  D         p.80

          .         .         .         .         .         .       g.6046
 TTCTTCACCATCTGGCTGGATCTCAACATGTTCCTACCCCTTGGGGTAGACTGCTGGATC       c.300
 F  F  T  I  W  L  D  L  N  M  F  L  P  L  G  V  D  C  W  I         p.100

          .  | 03      .         .         .         .         .    g.6185
 GATAACACCAG | GGTTGTCTACAACCGGAGCTCTGGGCTCGTGTCCAACGCCCCTGGTGTC    c.360
 D  N  T  R  |  V  V  Y  N  R  S  S  G  L  V  S  N  A  P  G  V      p.120

          .         .         .         .         .         .       g.6245
 CAGATCCGCGTCCCTGGCTTTGGCAAGACCTACTCTGTGGAGTACCTGGACAGCAGCAAG       c.420
 Q  I  R  V  P  G  F  G  K  T  Y  S  V  E  Y  L  D  S  S  K         p.140

         | 04.         .         .         .         .         .    g.6399
 CTGGCAG | GGTACCTGCACACACTGGTGCAGAACCTGGTCAACAATGGCTACGTGCGGGAC    c.480
 L  A  G |   Y  L  H  T  L  V  Q  N  L  V  N  N  G  Y  V  R  D      p.160

          .         .         .         .    | 05    .         .    g.6542
 GAGACTGTGCGCGCCGCCCCCTATGACTGGCGGCTGGAGCCCG | GCCAGCAGGAGGAGTAC    c.540
 E  T  V  R  A  A  P  Y  D  W  R  L  E  P  G |   Q  Q  E  E  Y      p.180

          .         .         .         .         .         .       g.6602
 TACCGCAAGCTCGCAGGGCTGGTGGAGGAGATGCACGCTGCCTATGGGAAGCCTGTCTTC       c.600
 Y  R  K  L  A  G  L  V  E  E  M  H  A  A  Y  G  K  P  V  F         p.200

          .         .         .         .         .         .       g.6662
 CTCATTGGCCACAGCCTCGGCTGTCTACACTTGCTCTATTTCCTGCTGCGCCAGCCCCAG       c.660
 L  I  G  H  S  L  G  C  L  H  L  L  Y  F  L  L  R  Q  P  Q         p.220

          .         .         .         .         .         .       g.6722
 GCCTGGAAGGACCGCTTTATTGATGGCTTCATCTCTCTTGGGGCTCCCTGGGGTGGCTCC       c.720
 A  W  K  D  R  F  I  D  G  F  I  S  L  G  A  P  W  G  G  S         p.240

          .         .         | 06         .         .         .    g.8666
 ATCAAGCCCATGCTGGTCTTGGCCTCAG | GTGACAACCAGGGCATCCCCATCATGTCCAGC    c.780
 I  K  P  M  L  V  L  A  S  G |   D  N  Q  G  I  P  I  M  S  S      p.260

          .         .         .         .         .         .       g.8726
 ATCAAGCTGAAAGAGGAGCAGCGCATAACCACCACCTCCCCCTGGATGTTTCCCTCTCGC       c.840
 I  K  L  K  E  E  Q  R  I  T  T  T  S  P  W  M  F  P  S  R         p.280

          .         .         .         .         .         .       g.8786
 ATGGCGTGGCCTGAGGACCACGTGTTCATTTCCACACCCAGCTTCAACTACACAGGCCGT       c.900
 M  A  W  P  E  D  H  V  F  I  S  T  P  S  F  N  Y  T  G  R         p.300

          .         .         .         .         .         .       g.8846
 GACTTCCAACGCTTCTTTGCAGACCTGCACTTTGAGGAAGGCTGGTACATGTGGCTGCAG       c.960
 D  F  Q  R  F  F  A  D  L  H  F  E  E  G  W  Y  M  W  L  Q         p.320

          .         .         .         .         .         .       g.8906
 TCACGTGACCTCCTGGCAGGACTCCCAGCACCTGGTGTGGAAGTATACTGTCTTTACGGC       c.1020
 S  R  D  L  L  A  G  L  P  A  P  G  V  E  V  Y  C  L  Y  G         p.340

          .         .         .         .         .         .       g.8966
 GTGGGCCTGCCCACGCCCCGCACCTACATCTACGACCACGGCTTCCCCTACACGGACCCT       c.1080
 V  G  L  P  T  P  R  T  Y  I  Y  D  H  G  F  P  Y  T  D  P         p.360

          .         .         .         .         .         .       g.9026
 GTGGGTGTGCTCTATGAGGATGGTGATGACACGGTGGCGACCCGCAGCACCGAGCTCTGT       c.1140
 V  G  V  L  Y  E  D  G  D  D  T  V  A  T  R  S  T  E  L  C         p.380

          .         .         .         .         .         .       g.9086
 GGCCTGTGGCAGGGCCGCCAGCCACAGCCTGTGCACCTGCTGCCCCTGCACGGGATACAG       c.1200
 G  L  W  Q  G  R  Q  P  Q  P  V  H  L  L  P  L  H  G  I  Q         p.400

          .         .         .         .         .         .       g.9146
 CATCTCAACATGGTCTTCAGCAACCTGACCCTGGAGCACATCAATGCCATCCTGCTGGGT       c.1260
 H  L  N  M  V  F  S  N  L  T  L  E  H  I  N  A  I  L  L  G         p.420

          .         .         .         .         .         .       g.9206
 GCCTACCGCCAGGGTCCCCCTGCATCCCCGACTGCCAGCCCAGAGCCCCCGCCTCCTGAA       c.1320
 A  Y  R  Q  G  P  P  A  S  P  T  A  S  P  E  P  P  P  P  E         p.440

                                                                    g.9209
 TAA                                                                c.1323
 X                                                                  p.440

          .         .                                               g.9229
 agaccttcctttgctaccgt                                               c.*20

 (downstream sequence)
Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The Lecithin-cholesterol acyltransferase protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.

Powered by LOVD v.3.0 Build 20a
©2004-2017 Leiden University Medical Center