LIM domain binding 3 (LDB3) - coding DNA reference sequence

(used for variant description)

(last modified December 30, 2019)


This file was created to facilitate the description of sequence variants on transcript NM_007078.2 in the LDB3 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_008876.1, covering LDB3 transcript NM_007078.2.


Please note that introns are available by clicking on the exon numbers above the sequence.
 (upstream sequence)
                                         .         .                g.5128
                                      aggcggccgctgacagcaccagc       c.-1

          .         .         .         .         .         .       g.5188
 ATGTCTTACAGTGTGACCCTGACTGGGCCCGGGCCCTGGGGCTTCCGTCTGCAGGGGGGC       c.60
 M  S  Y  S  V  T  L  T  G  P  G  P  W  G  F  R  L  Q  G  G         p.20

          .         .         .    | 02    .         .         .    g.15830
 AAGGACTTCAACATGCCCCTCACTATCTCCCGG | ATCACACCAGGCAGCAAGGCAGCCCAG    c.120
 K  D  F  N  M  P  L  T  I  S  R   | I  T  P  G  S  K  A  A  Q      p.40

          .         .         .         .         .         .       g.15890
 TCCCAGCTCAGCCAGGGTGACCTCGTGGTGGCCATTGACGGCGTCAACACAGACACCATG       c.180
 S  Q  L  S  Q  G  D  L  V  V  A  I  D  G  V  N  T  D  T  M         p.60

          .         .         .         .         .         .       g.15950
 ACCCACCTGGAAGCCCAGAACAAGATCAAGTCTGCCAGCTACAACTTGAGCCTCACCCTG       c.240
 T  H  L  E  A  Q  N  K  I  K  S  A  S  Y  N  L  S  L  T  L         p.80

       | 03  .         .         .         .         .         .    g.16573
 CAGAA | ATCAAAGCGTCCCATTCCCATCTCCACGACAGCACCTCCAGTCCAGACCCCTCTG    c.300
 Q  K  |  S  K  R  P  I  P  I  S  T  T  A  P  P  V  Q  T  P  L      p.100

          .         .  | 04      .         .         .         .    g.17911
 CCGGTGATCCCTCACCAGAAG | GACCCCGCTCTGGACACGAACGGCAGCCTGGTGGCACCC    c.360
 P  V  I  P  H  Q  K   | D  P  A  L  D  T  N  G  S  L  V  A  P      p.120

          .         .         .         .         .         .       g.17971
 AGCCCCAGCCCTGAGGCGAGGGCCAGCCCAGGCACCCCAGGCACCCCGGAGCTCAGGCCC       c.420
 S  P  S  P  E  A  R  A  S  P  G  T  P  G  T  P  E  L  R  P         p.140

          .         .         .         .         .         .       g.18031
 ACCTTTAGCCCTGCCTTCTCCCGGCCCTCCGCCTTCTCCTCACTCGCCGAGGCCTCTGAC       c.480
 T  F  S  P  A  F  S  R  P  S  A  F  S  S  L  A  E  A  S  D         p.160

          .         .         .         .         .         .       g.18091
 CCTGGCCCTCCGCGGGCCAGCCTGAGGGCCAAGACCAGCCCAGAGGGGGCCCGGGACCTA       c.540
 P  G  P  P  R  A  S  L  R  A  K  T  S  P  E  G  A  R  D  L         p.180

          .         .         .         .         .         .       g.18151
 CTCGGCCCAAAAGCCCTGCCGGGCTCGAGCCAGCCGAGGCAATATAACAACCCCATTGGC       c.600
 L  G  P  K  A  L  P  G  S  S  Q  P  R  Q  Y  N  N  P  I  G         p.200

          .         .         .         .         .         .       g.18211
 CTGTACTCGGCAGAGACCCTGAGGGAGATGGCTCAGATGTACCAGATGAGCCTCCGAGGG       c.660
 L  Y  S  A  E  T  L  R  E  M  A  Q  M  Y  Q  M  S  L  R  G         p.220

          .         .          | 05        .         .         .    g.28363
 AAGGCCTCGGGTGTCGGACTCCCAGGAGG | GAGCCTCCCTATTAAGGACCTTGCCGTAGAC    c.720
 K  A  S  G  V  G  L  P  G  G  |  S  L  P  I  K  D  L  A  V  D      p.240

          .         .         .         .         .         .       g.28423
 AGCGCCTCTCCCGTCTACCAGGCTGTGATTAAGAGCCAGAACAAGCCAGAAGATGAGGCT       c.780
 S  A  S  P  V  Y  Q  A  V  I  K  S  Q  N  K  P  E  D  E  A         p.260

          .         .         .         .         .         .       g.28483
 GACGAGTGGGCACGCCGTTCCTCCAACCTGCAGTCTCGCTCCTTCCGCATCCTGGCCCAG       c.840
 D  E  W  A  R  R  S  S  N  L  Q  S  R  S  F  R  I  L  A  Q         p.280

          .          | 06        .         .         .       | 07 . g.42971
 ATGACGGGGACAGAATTCA | TGCAAGACCCTGATGAAGAAGCTCTGCGAAGGTCAAG | CACC c.900
 M  T  G  T  E  F  M |   Q  D  P  D  E  E  A  L  R  R  S  S  |  T   p.300

          .         .         .         .         .         .       g.43031
 CCTATTGAGCATGCGCCGGTGTGCACCAGCCAGGCCACCACCCCGCTGCTGCCCGCTTCT       c.960
 P  I  E  H  A  P  V  C  T  S  Q  A  T  T  P  L  L  P  A  S         p.320

          .         .         .         .         .         .       g.43091
 GCCCAGCCACCTGCTGCTGCCTCTCCCAGTGCGGCTTCGCCACCCCTGGCCACAGCTGCT       c.1020
 A  Q  P  P  A  A  A  S  P  S  A  A  S  P  P  L  A  T  A  A         p.340

          .         .         .         .         .         .       g.43151
 GCCCACACTGCCATCGCCTCCGCCTCCACCACAGCCCCTGCTTCAAGTCCTGCCGACAGC       c.1080
 A  H  T  A  I  A  S  A  S  T  T  A  P  A  S  S  P  A  D  S         p.360

       | 08  .         .         .         .         .         .    g.46396
 CCAAG | GCCCCAGGCCTCTTCCTACAGCCCCGCAGTGGCCGCCTCTTCAGCACCTGCCACC    c.1140
 P  R  |  P  Q  A  S  S  Y  S  P  A  V  A  A  S  S  A  P  A  T      p.380

          .         .         .         .         .         .       g.46456
 CACACCAGCTACAGTGAGGGCCCCGCCGCCCCTGCACCCAAGCCCCGGGTTGTCACCACT       c.1200
 H  T  S  Y  S  E  G  P  A  A  P  A  P  K  P  R  V  V  T  T         p.400

          .         .         .  | 09      .         .         .    g.52792
 GCCAGCATCCGGCCTTCTGTCTACCAGCCAG | TGCCTGCATCTACCTACAGCCCGTCCCCA    c.1260
 A  S  I  R  P  S  V  Y  Q  P  V |   P  A  S  T  Y  S  P  S  P      p.420

          .         .         .         .         .         .       g.52852
 GGGGCCAATTACAGTCCCACTCCCTACACCCCCTCCCCTGCCCCTGCCTACACCCCCTCC       c.1320
 G  A  N  Y  S  P  T  P  Y  T  P  S  P  A  P  A  Y  T  P  S         p.440

          .         .         .         .         .         .       g.52912
 CCTGCCCCTGCCTACACCCCCTCACCTGTCCCCACCTACACTCCATCCCCAGCACCAGCC       c.1380
 P  A  P  A  Y  T  P  S  P  V  P  T  Y  T  P  S  P  A  P  A         p.460

          .         .         .         .         .         .       g.52972
 TATACCCCCTCACCTGCCCCCAACTATAACCCTGCACCCTCGGTGGCCTACAGCGGGGGC       c.1440
 Y  T  P  S  P  A  P  N  Y  N  P  A  P  S  V  A  Y  S  G  G         p.480

          .         .         .         .         .         .       g.53032
 CCTGCGGAGCCTGCCAGCCGTCCACCCTGGGTGACAGATGATAGCTTCTCCCAGAAGTTT       c.1500
 P  A  E  P  A  S  R  P  P  W  V  T  D  D  S  F  S  Q  K  F         p.500

          .         .         .         .         .         .       g.53092
 GCCCCGGGCAAGAGCACCACCTCCATCAGCAAGCAGACCCTGCCCCGGGGAGGCCCAGCC       c.1560
 A  P  G  K  S  T  T  S  I  S  K  Q  T  L  P  R  G  G  P  A         p.520

          .         .         .         .         .         .       g.53152
 TACACCCCAGCGGGTCCTCAGGTGCCACCACTTGCCAGGGGGACCGTCCAGAGGGCTGAG       c.1620
 Y  T  P  A  G  P  Q  V  P  P  L  A  R  G  T  V  Q  R  A  E         p.540

          .         .         .         .         .       | 10 .    g.54404
 CGATTCCCAGCCAGCAGCCGGACTCCACTCTGCGGTCACTGCAACAATGTCATCCG | GGGC    c.1680
 R  F  P  A  S  S  R  T  P  L  C  G  H  C  N  N  V  I  R  |  G      p.560

          .         .         .         .         .         .       g.54464
 CCATTTCTGGTAGCCATGGGCCGTTCTTGGCACCCTGAAGAGTTCACCTGTGCCTACTGC       c.1740
 P  F  L  V  A  M  G  R  S  W  H  P  E  E  F  T  C  A  Y  C         p.580

          .         .         .         .         .         .       g.54524
 AAGACTTCCCTGGCAGATGTGTGCTTTGTGGAAGAGCAGAACAACGTTTACTGTGAGCGA       c.1800
 K  T  S  L  A  D  V  C  F  V  E  E  Q  N  N  V  Y  C  E  R         p.600

          .         .         .         .         .        | 11.    g.55166
 TGTTATGAGCAATTCTTTGCCCCGCTGTGTGCCAAGTGCAACACCAAAATTATGGGG | GAA    c.1860
 C  Y  E  Q  F  F  A  P  L  C  A  K  C  N  T  K  I  M  G   | E      p.620

          .         .         .         .         .         .       g.55226
 GTAATGCATGCCTTGAGACAGACATGGCACACCACCTGCTTCGTCTGTGCGGCCTGCAAG       c.1920
 V  M  H  A  L  R  Q  T  W  H  T  T  C  F  V  C  A  A  C  K         p.640

          .         .         .         .         .         | 12    g.62575
 AAGCCTTTTGGGAACAGCCTCTTCCACATGGAAGACGGGGAGCCCTACTGCGAGAAAG | AC    c.1980
 K  P  F  G  N  S  L  F  H  M  E  D  G  E  P  Y  C  E  K  D |       p.660

          .         .         .         .         .         .       g.62635
 TACATCAATCTGTTCAGCACCAAGTGCCATGGCTGCGATTTCCCCGTGGAGGCTGGCGAC       c.2040
 Y  I  N  L  F  S  T  K  C  H  G  C  D  F  P  V  E  A  G  D         p.680

          .         .         .         .         .     | 13   .    g.69329
 AAGTTTATCGAAGCCCTGGGCCACACTTGGCACGACACCTGCTTCATTTGCGCA | GTCTGC    c.2100
 K  F  I  E  A  L  G  H  T  W  H  D  T  C  F  I  C  A   | V  C      p.700

          .         .         .         .         .         .       g.69389
 CATGTGAATCTGGAGGGGCAGCCGTTCTACTCCAAGAAGGACAGACCCCTGTGCAAGAAG       c.2160
 H  V  N  L  E  G  Q  P  F  Y  S  K  K  D  R  P  L  C  K  K         p.720

          .         .                                               g.69413
 CACGCACACACCATCAACTTGTAG                                           c.2184
 H  A  H  T  I  N  L  X                                             p.727

          .         .         .         .         .         .       g.69473
 gcggccaaggccgcctgtgctgacgaggcccggagctgctcctgctgctggcaacaaagg       c.*60

          .         .         .         .         .         .       g.69533
 attcgggaggctgatgtttcttctgaggggaatggggagagagaggaagcgactgagccc       c.*120

          .         .         .         .         .         .       g.69593
 tttggaagtataattttaggttttttcttctgtacacagatcgtgcatttgcatagttca       c.*180

          .         .         .         .         .         .       g.69653
 gactaggagccaaatgaagactcaaaaccaagctagttattaatccaagactggaattgt       c.*240

          .         .         .         .         .         .       g.69713
 acttcagacatttagagcagaattccaagaactcaaaagtgaaaagcaacaagcagcttt       c.*300

          .         .         .         .         .         .       g.69773
 cccaaagcgatacacttgctttggtcaccagaggaggacagagcttagagcagctgtgga       c.*360

          .         .         .         .         .         .       g.69833
 gaatctgaagcattctgcggagttcttaagcgctcccctggcaaacaaattgaagtgcca       c.*420

          .         .         .         .         .         .       g.69893
 aacagcactcgctgcagggtatttttagagtcatagctgagagcttgttagctaagaccc       c.*480

          .         .         .         .         .         .       g.69953
 attgggctttcctcaccaaaaaaggaagtgttattccattactagcgtcatggagctacc       c.*540

          .         .         .         .         .         .       g.70013
 tctgcgcatcagacttcagaccttgaacaaacttaaaaccttcttgggagcccggacgtc       c.*600

          .         .         .         .         .         .       g.70073
 caaagagatgtcttctgggagccactgggcaattgccagggctccaggaagggctctggc       c.*660

          .         .         .         .         .         .       g.70133
 tcaggttgcagacagctgagaaaagatggccctgtcagccaccctctctcagtctgaaac       c.*720

          .         .         .         .         .         .       g.70193
 atccaacatccccagaaggcttagctcctttttgaattgtgatgggaaagtagagttggg       c.*780

          .         .         .         .         .         .       g.70253
 tttttccagttttgctctgtggtgtgtgagagatttttttaaaggctttgggttgtcttt       c.*840

          .         .         .         .         .         .       g.70313
 ggcctttgtttagctttaagggttcgttagcatgagtgtccagtcgtgtgcatgaatttc       c.*900

          .         .         .         .         .         .       g.70373
 accccaacttgtgactgctcacttatgacgtctcccccagtaccctccatctcaaatagg       c.*960

          .         .         .         .         .         .       g.70433
 cttggtggcctgtggaaaagaagagagacagagagacagtgtctgaaacaggatggcaga       c.*1020

          .         .         .         .         .         .       g.70493
 ataggctcacatgcccaaactctgggtggggaagaggaaacttactttctgccaccctca       c.*1080

          .         .         .         .         .         .       g.70553
 gtaagaacacacgaggaggcaggacctcccaccttcaggtctgcatcatccttttcaaat       c.*1140

          .         .         .         .         .         .       g.70613
 gttcctttaaatgcagcacactgagtttgtacaattgtgttaactgctggaagggacaga       c.*1200

          .         .         .         .         .         .       g.70673
 tgcactgatatatatgcatttgctgttttggccaatattttgaaaatgtatgagctgagt       c.*1260

          .         .         .         .         .         .       g.70733
 tgatctagctattatttaagtatttattgaagtagaggggccttcaaactactttatact       c.*1320

          .         .         .         .         .         .       g.70793
 agtgatagtttgagttaggtaagcatcttaaagctgtttggtgataaagaaggcagctta       c.*1380

          .         .         .         .         .         .       g.70853
 gattctgtggttggaaacagtgtagtcgcttccctttttaggaagccctgttaatatgct       c.*1440

          .         .         .         .         .         .       g.70913
 cattgaaaacatggcattgaagcaggcacttgcgtggatgtttctcacttgagcacgata       c.*1500

          .         .         .         .         .         .       g.70973
 tttaggctctcttccaactcactctattctgtcctcactcctgttttggatttttctctt       c.*1560

          .         .         .         .         .         .       g.71033
 tgcatgtttgaaatgttttatgggaatgtattagaactcttttcttctaaggactgagac       c.*1620

          .         .         .         .         .         .       g.71093
 ttccaggggattgccatcttacctgtctcttctccatgagggagaaggaagcagctagct       c.*1680

          .         .         .         .         .         .       g.71153
 atgtccctagctgcaggaagcccctattttttccaagcacgaagccaccagtctccccca       c.*1740

          .         .         .         .         .         .       g.71213
 gggagcatcaggaagggacatggatgtgctcctgccacagggcccttcctacctttggat       c.*1800

          .         .         .         .         .         .       g.71273
 ctgtgagaaggtgaatacaaagcagcaggcagagtaaaatctgctgggactgcctggaga       c.*1860

          .         .         .         .         .         .       g.71333
 tttgtcaggagctgcagacaagtaccttggagcattctgttatttttggaaagttcaaat       c.*1920

          .         .         .         .         .         .       g.71393
 atgcagggacaaggaggttgctgactgtactgacaggctctaagtcattttctccaaaaa       c.*1980

          .         .         .         .         .         .       g.71453
 ctatctattcaattatcaggggctggtcttgaggaaggaaaaaaaaaaaaaaacgttccc       c.*2040

          .         .         .         .         .         .       g.71513
 agaattcagtttccaaaatctctttttaaagggtttacacacacacacacacacacacac       c.*2100

          .         .         .         .         .         .       g.71573
 acacacacacacacacacacacacgatcattaaaaagtgtatgctctttaagaagaaaag       c.*2160

          .         .         .         .         .         .       g.71633
 taaaatatctcaaaggacggtttcaccaccgtcctttattgaatcaatttttctacattt       c.*2220

          .         .         .         .         .         .       g.71693
 cagagcaagtgtagattctgagggactcctatttgccaaaaagacaaaactagcaaaaaa       c.*2280

          .         .         .         .         .         .       g.71753
 aaaacaaaaaaacaaaaaaaaaaccacttaaaaggtagcaggaaaagaaggtagttttga       c.*2340

          .         .         .         .         .         .       g.71813
 gtgtggttcactcagtgtctgtgagtctggtgtagtgtcaggagtaaggccgtgtctagc       c.*2400

          .         .         .         .         .         .       g.71873
 tcaagtttacatttggatgtcctacaacactaaacaaaatttttcataatccatggtggg       c.*2460

          .         .         .         .         .         .       g.71933
 gagcacactttggagctacatttcttgtctcctcattgttgacattaattaaacatttat       c.*2520

          .         .         .         .         .         .       g.71993
 aggccaggcacagtggctcacgcctgttatcccagcactttgggaggccgaggcaggtga       c.*2580

          .         .         .         .         .         .       g.72053
 atcacctgaggtcaggagtttgaaaccagcctggccaatatggtgaaaccccatctctac       c.*2640

          .         .         .         .         .         .       g.72113
 taaaaatacacaaaattagccaggtgtggtggcaggcgcctgtagttccagctacttggg       c.*2700

          .         .         .         .         .         .       g.72173
 aggctgaggcaggaatctcctgaatcctggaggcggaggttgcagtgagccgagattatg       c.*2760

          .         .         .         .         .         .       g.72233
 ccattgcactccagcctgggcaacaggagcgaaactccgttgcaaaaaaaaaaaaaaaaa       c.*2820

          .         .         .         .         .         .       g.72293
 aaaaattataatcacaactttttgcaatggagtgacttatatctgcagcttatatctgca       c.*2880

          .         .         .         .         .         .       g.72353
 gtgtttgtgttaggaacctagcttttataatgtgttaactttttaactcagtattctggc       c.*2940

          .         .         .         .         .         .       g.72413
 tttgggattttttgttttgtttttggaaacatttcagaagtggaatgtagcctgttaaag       c.*3000

          .         .         .         .         .         .       g.72473
 gtgtgcacaaaaatattttgcatgtgtttttttttttgcctgtgtgaattctacttttta       c.*3060

          .         .         .                                     g.72505
 gcaaaaataaagccccccaaaggatgtgcaaa                                   c.*3092

 (downstream sequence)
Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The LIM domain binding 3 protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.

Powered by LOVD v.3.0 Build 22
©2004-2019 Leiden University Medical Center