lens intrinsic membrane protein 2, 19kDa (LIM2) - coding DNA reference sequence

(used for variant description)

(last modified March 21, 2023)

This file was created to facilitate the description of sequence variants on transcript NM_001161748.1 in the LIM2 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NC_000019.9, covering LIM2 transcript NM_001161748.1.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
                     .         .         .         .    | 02        g.5513
                 gtggcagaaggagggctcgggcaggctctgccactcag | atcacc    c.-1

          .         .         .         .         .         .       g.5573
 ATGTACAGCTTCATGGGTGGTGGCCTGTTCTGTGCCTGGGTGGGGACCATCCTCCTGGTG       c.60
 M  Y  S  F  M  G  G  G  L  F  C  A  W  V  G  T  I  L  L  V         p.20

          .         .         .         .         .         .       g.5633
 GTGGCCATGGCAACAGACCACTGGATGCAGTACCGGCTGTCAGGGTCCTTCGCCCACCAG       c.120
 V  A  M  A  T  D  H  W  M  Q  Y  R  L  S  G  S  F  A  H  Q         p.40

          .         .         .         .         .      | 03  .    g.10394
 GGCCTGTGGCGGTACTGCCTGGGCAACAAGTGCTACCTGCAGACAGACAGCATCG | CATAC    c.180
 G  L  W  R  Y  C  L  G  N  K  C  Y  L  Q  T  D  S  I  A |   Y      p.60

          .         .         .         .         .         .       g.10454
 TGGAATGCCACCCGGGCCTTCATGATCCTGTCTGCCCTATGCGCCATCTCCGGCATCATC       c.240
 W  N  A  T  R  A  F  M  I  L  S  A  L  C  A  I  S  G  I  I         p.80

          .         .         .         .         .         .       g.10514
 ATGGGCATCATGGCCTTCGCTCATCAGCCTACCTTCTCCCGCATCTCCCGGCCCTTCTCT       c.300
 M  G  I  M  A  F  A  H  Q  P  T  F  S  R  I  S  R  P  F  S         p.100

          .         .      | 04  .         .         .         .    g.12352
 GCTGGCATCATGTTTTTTTCCTCAA | CCCTTTTCGTCGTGTTGGCCTTGGCCATCTACACT    c.360
 A  G  I  M  F  F  S  S  T |   L  F  V  V  L  A  L  A  I  Y  T      p.120

          .         .         .         .         .         .       g.12412
 GGAGTCACCGTCAGCTTCCTGGGCCGCCGCTTTGGGGACTGGCGCTTTTCCTGGTCCTAC       c.420
 G  V  T  V  S  F  L  G  R  R  F  G  D  W  R  F  S  W  S  Y         p.140

          .         .         .         . | 05       .         .    g.12714
 ATCCTGGGCTGGGTGGCAGTGCTCATGACGTTCTTCGCAG | GGATTTTCTACATGTGCGCC    c.480
 I  L  G  W  V  A  V  L  M  T  F  F  A  G |   I  F  Y  M  C  A      p.160

          .         .         .         .                           g.12756
 TACCGGGTGCATGAATGCCGGCGCCTGTCTACACCCCGCTGA                         c.522
 Y  R  V  H  E  C  R  R  L  S  T  P  R  X                           p.173

          .         .         .         .         .         .       g.12816
 gcccaaatgtgtcccccaacttcatctggaagttaaagtgaggccactgaagaggaggag       c.*60

          .         .         .         .         .         .       g.12876
 gagggtctagaggcctgaaatcctggttcctaggggaatgagggggctcagttctggact       c.*120

          .         .         .         .         .         .       g.12936
 gtgggtttgtggggggaggctgactcctggtcctaggctggaaggaggaagaatagggcc       c.*180

          .         .         .         .         .         .       g.12996
 catgggagggagctgagaagactcaagtccccgtctgcctggcaggttgttagaaaaatg       c.*240

          .         .         .         .         .                 g.13048
 gactatccattagagcaactttctggggcctaataaaactgatgtgaaacta               c.*292

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The Lens intrinsic membrane protein 2, 19kDa protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.