lamin A/C (LMNA) - coding DNA reference sequence

(used for variant description)

(last modified December 30, 2019)

This file was created to facilitate the description of sequence variants on transcript NM_170707.3 in the LMNA gene based on a coding DNA reference sequence following the HGVS recommendations. The sequence was taken from NG_008692.1, covering LMNA transcript variant 1 (NM_170707.2).  Lamin-C is encoded by transcript variant 2, terminating in intron 10 (NM_005572.3). Transcript variant 3 (NM_170708.2) skips exon 10.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
                                                    aggaggacc       c.-241

 .         .         .         .         .         .                g.37161
 tattagagcctttgccccggcgtcggtgactcagtgttcgcgggagcgccgcacctacac       c.-181

 .         .         .         .         .         .                g.37221
 cagccaacccagatcccgaggtccgacagcgcccggcccagatccccacgcctgccagga       c.-121

 .         .         .         .         .         .                g.37281
 gcaagccgagagccagccggccggcgcactccgactccgagcagtctctgtccttcgacc       c.-61

 .         .         .         .         .         .                g.37341
 cgagccccgcgccctttccgggacccctgccccgcgggcagcgctgccaacctgccggcc       c.-1

          .         .         .         .         .         .       g.37401
 M  E  T  P  S  Q  R  R  A  T  R  S  G  A  Q  A  S  S  T  P         p.20

          .         .         .         .         .         .       g.37461
 L  S  P  T  R  I  T  R  L  Q  E  K  E  D  L  Q  E  L  N  D         p.40

          .         .         .         .         .         .       g.37521
 R  L  A  V  Y  I  D  R  V  R  S  L  E  T  E  N  A  G  L  R         p.60

          .         .         .         .         .         .       g.37581
 L  R  I  T  E  S  E  E  V  V  S  R  E  V  S  G  I  K  A  A         p.80

          .         .         .         .         .         .       g.37641
 Y  E  A  E  L  G  D  A  R  K  T  L  D  S  V  A  K  E  R  A         p.100

          .         .         .         .         .       | 02 .    g.53043
 R  L  Q  L  E  L  S  K  V  R  E  E  F  K  E  L  K  A  R  |  N      p.120

          .         .         .         .         .         .       g.53103
 T  K  K  E  G  D  L  I  A  A  Q  A  R  L  K  D  L  E  A  L         p.140

          .         .         .         .         .         .       g.53163
 L  N  S  K  E  A  A  L  S  T  A  L  S  E  K  R  T  L  E  G         p.160

          .         .         .    | 03    .         .         .    g.56852
 E  L  H  D  L  R  G  Q  V  A  K   | L  E  A  A  L  G  E  A  K      p.180

          .         .         .         .         .         .       g.56912
 K  Q  L  Q  D  E  M  L  R  R  V  D  A  E  N  R  L  Q  T  M         p.200

          .         .         .          | 04        .         .    g.57248
 K  E  E  L  D  F  Q  K  N  I  Y  S  E   | E  L  R  E  T  K  R      p.220

          .         .         .         .         .         .       g.57308
 R  H  E  T  R  L  V  E  I  D  N  G  K  Q  R  E  F  E  S  R         p.240

          .         .         .         .         .         .       g.57368
 L  A  D  A  L  Q  E  L  R  A  Q  H  E  D  Q  V  E  Q  Y  K         p.260

          .         .         . | 05       .         .         .    g.57639
 K  E  L  E  K  T  Y  S  A  K   | L  D  N  A  R  Q  S  A  E  R      p.280

          .         .         .         .         .         .       g.57699
 N  S  N  L  V  G  A  A  H  E  E  L  Q  Q  S  R  I  R  I  D         p.300

          .         .         .       | 06 .         .         .    g.58347
 S  L  S  A  Q  L  S  Q  L  Q  K  Q   | L  A  A  K  E  A  K  L      p.320

          .         .         .         .         .         .       g.58407
 R  D  L  E  D  S  L  A  R  E  R  D  T  S  R  R  L  L  A  E         p.340

          .         .         .         .         .         .       g.58467
 K  E  R  E  M  A  E  M  R  A  R  M  Q  Q  Q  L  D  E  Y  Q         p.360

          .         .         .         .         .         .       g.58527
 E  L  L  D  I  K  L  A  L  D  M  E  I  H  A  Y  R  K  L  L         p.380

          .        | 07.         .         .         .         .    g.58679
 E  G  E  E  E  R  |  L  R  L  S  P  S  P  T  S  Q  R  S  R  G      p.400

          .         .         .         .         .         .       g.58739
 R  A  S  S  H  S  S  Q  T  Q  G  G  G  S  V  T  K  K  R  K         p.420

          .         .         .         .         .         .       g.58799
 L  E  S  T  E  S  R  S  S  F  S  Q  H  A  R  T  S  G  R  V         p.440

          .         .         .         .         .         .       g.58859
 A  V  E  E  V  D  E  E  G  K  F  V  R  L  R  N  K  S  N  E         p.460

  | 08       .         .         .         .         .         .    g.59403
  | D  Q  S  M  G  N  W  Q  I  K  R  Q  N  G  D  D  P  L  L  T      p.480

          .         .         .         .         | 09         .    g.59547
 Y  R  F  P  P  K  F  T  L  K  A  G  Q  V  V  T   | I  W  A  A      p.500

          .         .         .         .         .         .       g.59607
 G  A  G  A  T  H  S  P  P  T  D  L  V  W  K  A  Q  N  T  W         p.520

          .         .         .         .         | 10         .    g.60088
 G  C  G  N  S  L  R  T  A  L  I  N  S  T  G  E   | E  V  A  M      p.540

          .         .         .         .         .         .       g.60148
 R  K  L  V  R  S  V  T  V  V  E  D  D  E  D  E  D  G  D  D         p.560

          .         | 11         .         .         .         .    g.60952
 L  L  H  H  H  H   | G  S  H  C  S  S  S  G  D  P  A  E  Y  N      p.580

          .         .         .         .         .         .       g.61012
 L  R  S  R  T  V  L  C  G  T  C  G  Q  P  A  D  K  A  S  A         p.600

          .         .         .         .         .         .       g.61072
 S  G  S  G  A  Q  V  G  G  P  I  S  S  G  S  S  A  S  S  V         p.620

          .         .         .         .         .         .       g.61132
 T  V  T  R  S  Y  R  S  V  G  G  S  G  G  G  S  F  G  D  N         p.640

          .         .         .         .         | 12         .    g.61514
 L  V  T  R  S  Y  L  L  G  N  S  S  P  R  T  Q   | S  P  Q  N      p.660

          .                                                         g.61529
 TGCAGCATCATGTAA                                                    c.1995
 C  S  I  M  X                                                      p.664

          .         .         .         .         .         .       g.61589
 tctgggacctgccaggcaggggtgggggtggaggcttcctgcgtcctcctcacctcatgc       c.*60

          .         .         .         .         .         .       g.61649
 ccaccccctgccctgcacgtcatgggagggggcttgaagccaaagaaaaataaccctttg       c.*120

          .         .         .         .         .         .       g.61709
 gtttttttcttctgtatttttttttctaagagaagttattttctacagtggttttatact       c.*180

          .         .         .         .         .         .       g.61769
 gaaggaaaaacacaagcaaaaaaaaaaaaaagcatctatctcatctatctcaatcctaat       c.*240

          .         .         .         .         .         .       g.61829
 ttctcctcccttccttttccctgcttccaggaaactccacatctgccttaaaaccaaaga       c.*300

          .         .         .         .         .         .       g.61889
 gggcttcctctagaagccaagggaaaggggtgcttttatagaggctagcttctgcttttc       c.*360

          .         .         .         .         .         .       g.61949
 tgccctggctgctgcccccaccccggggaccctgtgacatggtgcctgagaggcaggcat       c.*420

          .         .         .         .         .         .       g.62009
 agaggcttctccgccagcctcctctggacggcaggctcactgccaggccagcctccgaga       c.*480

          .         .         .         .         .         .       g.62069
 gggagagagagagagagaggacagcttgagccgggcccctgggcttggcctgctgtgatt       c.*540

          .         .         .         .         .         .       g.62129
 ccactacacctggctgaggttcctctgcctgccccgcccccagtccccacccctgccccc       c.*600

          .         .         .         .         .         .       g.62189
 agccccggggtgagtccattctcccaggtaccagctgcgcttgcttttctgtattttatt       c.*660

          .         .         .         .         .         .       g.62249
 tagacaagagatgggaatgaggtgggaggtggaagaagggagaagaaaggtgagtttgag       c.*720

          .         .         .         .         .         .       g.62309
 ctgccttccctagctttagaccctgggtgggctctgtgcagtcactggaggttgaagcca       c.*780

          .         .         .         .         .         .       g.62369
 agtggggtgctgggaggagggagagggaggtcactggaaaggggagagcctgctggcacc       c.*840

          .         .         .         .         .         .       g.62429
 caccgtggaggaggaaggcaagagggggtggaggggtgtggcagtggttttggcaaacgc       c.*900

          .         .         .         .         .         .       g.62489
 taaagagcccttgcctccccatttcccatctgcaccccttctctcctccccaaatcaata       c.*960

          .         .                                               g.62512
 cactagttgtttctacccctggc                                            c.*983

 (downstream sequence)
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The Lamin A/C protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.

Powered by LOVD v.3.0 Build 22
©2004-2019 Leiden University Medical Center