leucine rich repeat and sterile alpha motif containing 1 (LRSAM1) - 333 nt intron 12 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.33080
gtttgtgagccgcctgctagggtccagcctggctgcatcccccagccagtggcctcctgg  c.903+60

         .         .         .         .         .         .  g.33140
cttgggccaaggtccctcggatgtggaaaggcagtgggatgaagctgtcacttccttctg  c.903+120

         .         .         .         .         g.33187
tcccccagcacctgggagggcccttacagatcacccagcccagcctc  c.903+167

--------------------- middle of intron ---------------------
   g.33188          .         .         .         .           g.33233
   c.904-166  cccgtgtgcagatggacactgtagcctactgggaggagctggccgg  c.904-121

.         .         .         .         .         .           g.33293
aggtcacacaaaaaggattggcaaggcagggtgggaaagccagcctcctaaccccagtca  c.904-61

.         .         .         .         .         .           g.33353
gtacccctcacggcgtctgagggggtcccaggggctcaggacccctacctccggctgcag  c.904-1


Powered by LOVD v.3.0 Build 21b
©2004-2019 Leiden University Medical Center