lymphotoxin alpha (TNF superfamily, member 1) (LTA) - coding DNA reference sequence

(used for variant description)

(last modified February 13, 2023)

This file was created to facilitate the description of sequence variants on transcript NM_000595.3 in the LTA gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NC_000006.11, covering LTA transcript NM_000595.3.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
                     .         .         .         .                g.5237
                   gcacagcaggtgaggctctcctgccccatctccttgggctgc       c.-121

 .         .         .         .         .         .                g.5297
 ccgtgcttcgtgctttggactaccgcccagcagtgtcctgccctctgcctgggcctcggt       c.-61

 .         .         .         .         .         . | 02           g.5644
 ccctcctgcacctgctgcctggatccccggcctgcctgggcctgggccttg | gttctcccc    c.-1

          .         .         .         .         .         .       g.5704
 ATGACACCACCTGAACGTCTCTTCCTCCCAAGGGTGTGTGGCACCACCCTACACCTCCTC       c.60
 M  T  P  P  E  R  L  F  L  P  R  V  C  G  T  T  L  H  L  L         p.20

          .         .         .          | 03        .         .    g.5850
 CTTCTGGGGCTGCTGCTGGTTCTGCTGCCTGGGGCCCAG | GGGCTCCCTGGTGTTGGCCTC    c.120
 L  L  G  L  L  L  V  L  L  P  G  A  Q   | G  L  P  G  V  G  L      p.40

          .         .         .         .         .         .       g.5910
 ACACCTTCAGCTGCCCAGACTGCCCGTCAGCACCCCAAGATGCATCTTGCCCACAGCACC       c.180
 T  P  S  A  A  Q  T  A  R  Q  H  P  K  M  H  L  A  H  S  T         p.60

          .         .      | 04  .         .         .         .    g.6217
 CTCAAACCTGCTGCTCACCTCATTG | GAGACCCCAGCAAGCAGAACTCACTGCTCTGGAGA    c.240
 L  K  P  A  A  H  L  I  G |   D  P  S  K  Q  N  S  L  L  W  R      p.80

          .         .         .         .         .         .       g.6277
 GCAAACACGGACCGTGCCTTCCTCCAGGATGGTTTCTCCTTGAGCAACAATTCTCTCCTG       c.300
 A  N  T  D  R  A  F  L  Q  D  G  F  S  L  S  N  N  S  L  L         p.100

          .         .         .         .         .         .       g.6337
 GTCCCCACCAGTGGCATCTACTTCGTCTACTCCCAGGTGGTCTTCTCTGGGAAAGCCTAC       c.360
 V  P  T  S  G  I  Y  F  V  Y  S  Q  V  V  F  S  G  K  A  Y         p.120

          .         .         .         .         .         .       g.6397
 TCTCCCAAGGCCACCTCCTCCCCACTCTACCTGGCCCATGAGGTCCAGCTCTTCTCCTCC       c.420
 S  P  K  A  T  S  S  P  L  Y  L  A  H  E  V  Q  L  F  S  S         p.140

          .         .         .         .         .         .       g.6457
 CAGTACCCCTTCCATGTGCCTCTCCTCAGCTCCCAGAAGATGGTGTATCCAGGGCTGCAG       c.480
 Q  Y  P  F  H  V  P  L  L  S  S  Q  K  M  V  Y  P  G  L  Q         p.160

          .         .         .         .         .         .       g.6517
 GAACCCTGGCTGCACTCGATGTACCACGGGGCTGCGTTCCAGCTCACCCAGGGAGACCAG       c.540
 E  P  W  L  H  S  M  Y  H  G  A  A  F  Q  L  T  Q  G  D  Q         p.180

          .         .         .         .         .         .       g.6577
 CTATCCACCCACACAGATGGCATCCCCCACCTAGTCCTCAGCCCTAGTACTGTCTTCTTT       c.600
 L  S  T  H  T  D  G  I  P  H  L  V  L  S  P  S  T  V  F  F         p.200

          .                                                         g.6595
 GGAGCCTTCGCTCTGTAG                                                 c.618
 G  A  F  A  L  X                                                   p.205

          .         .         .         .         .         .       g.6655
 aacttggaaaaatccagaaagaaaaaataattgatttcaagaccttctccccattctgcc       c.*60

          .         .         .         .         .         .       g.6715
 tccattctgaccatttcaggggtcgtcaccacctctcctttggccattccaacagctcaa       c.*120

          .         .         .         .         .         .       g.6775
 gtcttccctgatcaagtcaccggagctttcaaagaaggaattctaggcatcccaggggac       c.*180

          .         .         .         .         .         .       g.6835
 cacacctccctgaaccatccctgatgtctgtctggctgaggatttcaagcctgcctagga       c.*240

          .         .         .         .         .         .       g.6895
 attcccagcccaaagctgttggtctgtcccaccagctaggtggggcctagatccacacac       c.*300

          .         .         .         .         .         .       g.6955
 agaggaagagcaggcacatggaggagcttgggggatgactagaggcagggaggggactat       c.*360

          .         .         .         .         .         .       g.7015
 ttatgaaggcaaaaaaattaaattatttatttatggaggatggagagaggggaataatag       c.*420

          .         .         .         .         .         .       g.7075
 aagaacatccaaggagaaacagagacaggcccaagagatgaagagtgagagggcatgcgc       c.*480

          .         .         .         .         .         .       g.7135
 acaaggctgaccaagagagaaagaagtaggcatgagggatcacagggccccagaaggcag       c.*540

          .         .         .         .         .         .       g.7195
 ggaaaggctctgaaagccagctgccgaccagagccccacacggaggcatctgcaccctcg       c.*600

          .         .         .                                     g.7226
 atgaagcccaataaacctcttttctctgaaa                                    c.*631

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The Lymphotoxin alpha (TNF superfamily, member 1) protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.