LYR motif containing 4 (LYRM4) - coding DNA reference sequence

(used for variant description)

(last modified September 29, 2018)

This file was created to facilitate the description of sequence variants on transcript NM_020408.4 in the LYRM4 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_051651.1, covering LYRM4 transcript NM_020408.4.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
                                         .         .                g.5026
                                   gcgcccgcccccgaagcggcgcggga       c.-181

 .         .         .         .         .         .                g.5086
 cgcctggcgccgtccgcgatccgcagggctgcccgcttaggcttaggcccggcccgctgg       c.-121

 .         .         .         .         .         .                g.5146
 caaagccgagccgcagcattttatttcgttcgtggtttccgcacaggctggagtttcgtg       c.-61

 .         .         .         .         .         .                g.5206
 ggttgggtcgtacttgggacctcggcgaagaggacccgtttatttttttttctttccaaa       c.-1

          .         .         .         .         .         .       g.5266
 ATGGCAGCCTCCAGTCGCGCACAAGTGTTATCTCTGTACCGGGCGATGCTGAGAGAGAGC       c.60
 M  A  A  S  S  R  A  Q  V  L  S  L  Y  R  A  M  L  R  E  S         p.20

          .         .       | 02 .         .         .         .    g.49235
 AAGCGTTTCAGCGCCTACAATTACAG | AACATATGCTGTCAGGAGGATAAGAGATGCCTTC    c.120
 K  R  F  S  A  Y  N  Y  R  |  T  Y  A  V  R  R  I  R  D  A  F      p.40

          .         .         .         .         .         .       g.49295
 AGAGAAAATAAAAATGTAAAGGATCCTGTAGAAATTCAAACCCTAGTGAATAAAGCCAAG       c.180
 R  E  N  K  N  V  K  D  P  V  E  I  Q  T  L  V  N  K  A  K         p.60

          .         .        | 03.         .         .         .    g.156480
 AGAGACCTTGGAGTAATTCGTCGACAG | GTCCACATTGGCCAACTGTATTCAACTGACAAG    c.240
 R  D  L  G  V  I  R  R  Q   | V  H  I  G  Q  L  Y  S  T  D  K      p.80

          .         .         .                                     g.156516
 CTGATCATTGAGAATCGAGACATGCCCAGGACCTAG                               c.276
 L  I  I  E  N  R  D  M  P  R  T  X                                 p.91

          .         .         .         .         .         .       g.156576
 caagccggggaccagccaccagtggcggccagggaccaccttcagcatccactctctgtt       c.*60

          .         .         .         .         .         .       g.156636
 tgagatgggggctcccaaaaccagcttacaatagccttttgcgctgcctgtcctgtggga       c.*120

          .         .         .         .         .         .       g.156696
 gctgataaaccaagtcacatttgcattctgttgcaggcttagtgaaaaaggactgctgtc       c.*180

          .         .         .         .         .         .       g.156756
 tttccttggttcaagtgttagaatggagagctggagttcgttcagaatagtgctgtgtgt       c.*240

          .         .         .         .         .         .       g.156816
 taccacgtctcccctgcaccccattcctaccttgtagctcatgaccattgtgtatagcat       c.*300

          .         .         .         .         .         .       g.156876
 ttctacactttgtttcttggtccttggcaataaaaagaatgatctccctgagcctttgac       c.*360

          .         .         .         .         .         .       g.156936
 cccagataaacccctcccaattaatgcattttcatttcctactgatacaaggcctggaga       c.*420

          .         .         .         .         .         .       g.156996
 gggctgttgggggccctcagggagggttcaactctgagacgagaactgccttggtgaagg       c.*480

          .         .         .         .         .         .       g.157056
 caagttcaagcaccacttgagactgggggcagcatggagtagggcagggctacggggata       c.*540

          .         .         .         .         .         .       g.157116
 cacggtgcaccctgcaacttatacctgagcccagtacaacaaaggtgacgggtgtgtagg       c.*600

          .         .         .         .         .         .       g.157176
 tacacacccagagatggagcactgcagatcagcaacctcagccccacctgggaatttgct       c.*660

          .         .         .         .         .         .       g.157236
 ggaaatgcaggctcaagcccctccccacacctggtgaatgagagagccccagcctgaccc       c.*720

          .         .         .         .         .         .       g.157296
 aagcccagggcgactcccataccctgaagcctggggcatgctgggcagcaccggtgccca       c.*780

          .         .         .         .         .         .       g.157356
 aatctggctggtggacagaagcacctggagagttggagagctttttaaaaagacatctct       c.*840

          .         .         .         .         .         .       g.157416
 cagcacttccctctctgcagattctgactcagtaagtgaggggtgaggcacagtcatttt       c.*900

          .         .         .         .         .         .       g.157476
 tctctattctgaagctctcccactgttttcaatgtttaaccaactggggacccctgctct       c.*960

          .         .         .         .                           g.157520
 ttaagtatattacaggtaataaagatattgtttgtatgctttta                       c.*1004

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The LYR motif containing 4 protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.