mab-21-like 1 (C. elegans) (MAB21L1) - coding DNA reference sequence

(used for variant description)

(last modified June 28, 2021)


This file was created to facilitate the description of sequence variants on transcript NM_005584.4 in the MAB21L1 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NC_000013.10, covering MAB21L1 transcript NM_005584.4.


Please note that introns are available by clicking on the exon numbers above the sequence.
 (upstream sequence)
                                                   .                g.5017
                                            gctcttagacaaaccaa       c.-541

 .         .         .         .         .         .                g.5077
 cagcagcttcttctgacatatacacacgcacactcaccccggacacacactcagcacact       c.-481

 .         .         .         .         .         .                g.5137
 tttcctccatttgattaacagtgctgcacacacaatgattacgggaaagcgcaaataaat       c.-421

 .         .         .         .         .         .                g.5197
 acggaaaggggtgcttattttgactactggaagagctttgctgggtctcagcgcaacttt       c.-361

 .         .         .         .         .         .                g.5257
 tgttttttattcctgagaaggtgatctctccatgcggttctctcacacaaggattcttta       c.-301

 .         .         .         .         .         .                g.5317
 aaagaggaagagagacaagcagaggggggaggacagtctttcactttaagaacggctggg       c.-241

 .         .         .         .         .         .                g.5377
 ctcaaagataaaaggaagggaaaagcagcagcagcagcagcagcagcagcagcagcagca       c.-181

 .         .         .         .         .         .                g.5437
 gcagcagcagcagcagcagcagggaaaccaacgctgcagcacttccgaaaggcatttttg       c.-121

 .         .         .         .         .         .                g.5497
 atccatttctgagtgttgcggcccgtttctccaccgaagttggctccagctctagcagcc       c.-61

 .         .         .         .         .         .                g.5557
 gcattggatcccacagcttactgcgagactccggtgtacaatccggatctctgccccaac       c.-1

          .         .         .         .         .         .       g.5617
 ATGATTGCGGCCCAGGCCAAGCTGGTCTACCATCTGAATAAATACTACAACGAAAAATGC       c.60
 M  I  A  A  Q  A  K  L  V  Y  H  L  N  K  Y  Y  N  E  K  C         p.20

          .         .         .         .         .         .       g.5677
 CAAGCCAGGAAAGCTGCCATTGCCAAAACTATCCGGGAAGTCTGCAAAGTAGTTTCCGAC       c.120
 Q  A  R  K  A  A  I  A  K  T  I  R  E  V  C  K  V  V  S  D         p.40

          .         .         .         .         .         .       g.5737
 GTACTGAAGGAAGTGGAAGTGCAGGAGCCGCGGTTCATCAGCTCTCTCAACGAGATGGAC       c.180
 V  L  K  E  V  E  V  Q  E  P  R  F  I  S  S  L  N  E  M  D         p.60

          .         .         .         .         .         .       g.5797
 AATCGCTACGAGGGCCTCGAGGTCATCTCCCCCACCGAATTTGAAGTGGTGCTTTATCTC       c.240
 N  R  Y  E  G  L  E  V  I  S  P  T  E  F  E  V  V  L  Y  L         p.80

          .         .         .         .         .         .       g.5857
 AACCAAATGGGGGTGTTCAACTTCGTGGACGATGGCTCACTGCCCGGCTGCGCGGTGCTG       c.300
 N  Q  M  G  V  F  N  F  V  D  D  G  S  L  P  G  C  A  V  L         p.100

          .         .         .         .         .         .       g.5917
 AAGTTGAGCGACGGGCGCAAGAGGAGCATGTCCCTCTGGGTGGAATTCATTACCGCCTCC       c.360
 K  L  S  D  G  R  K  R  S  M  S  L  W  V  E  F  I  T  A  S         p.120

          .         .         .         .         .         .       g.5977
 GGCTACCTCTCGGCGCGCAAAATCCGGTCCAGGTTTCAGACGCTGGTGGCTCAAGCGGTA       c.420
 G  Y  L  S  A  R  K  I  R  S  R  F  Q  T  L  V  A  Q  A  V         p.140

          .         .         .         .         .         .       g.6037
 GACAAATGTAGCTACCGGGATGTGGTAAAGATGGTGGCAGACACCAGCGAAGTGAAACTG       c.480
 D  K  C  S  Y  R  D  V  V  K  M  V  A  D  T  S  E  V  K  L         p.160

          .         .         .         .         .         .       g.6097
 AGAATCCGAGATAGGTACGTGGTGCAGATCACGCCGGCCTTTAAATGCACCGGGATCTGG       c.540
 R  I  R  D  R  Y  V  V  Q  I  T  P  A  F  K  C  T  G  I  W         p.180

          .         .         .         .         .         .       g.6157
 CCGAGGAGTGCTGCCCACTGGCCACTTCCCCACATCCCCTGGCCGGGACCCAACCGGGTG       c.600
 P  R  S  A  A  H  W  P  L  P  H  I  P  W  P  G  P  N  R  V         p.200

          .         .         .         .         .         .       g.6217
 GCGGAGGTCAAGGCGGAAGGTTTCAATCTCTTGTCCAAGGAGTGCCACTCCTTGGCCGGC       c.660
 A  E  V  K  A  E  G  F  N  L  L  S  K  E  C  H  S  L  A  G         p.220

          .         .         .         .         .         .       g.6277
 AAGCAGAGCTCGGCGGAGAGCGACGCCTGGGTGCTGCAGTTCGCGGAGGCAGAGAACAGA       c.720
 K  Q  S  S  A  E  S  D  A  W  V  L  Q  F  A  E  A  E  N  R         p.240

          .         .         .         .         .         .       g.6337
 CTGCAGATGGGGGGCTGCAGAAAGAAGTGCCTCTCCATCCTCAAAACCTTAAGGGATCGT       c.780
 L  Q  M  G  G  C  R  K  K  C  L  S  I  L  K  T  L  R  D  R         p.260

          .         .         .         .         .         .       g.6397
 CACCTTGAACTGCCGGGCCAGCCCTTGAACAATTACCATATGAAGACTCTGGTTTCCTAC       c.840
 H  L  E  L  P  G  Q  P  L  N  N  Y  H  M  K  T  L  V  S  Y         p.280

          .         .         .         .         .         .       g.6457
 GAGTGTGAAAAGCATCCCCGAGAGTCGGACTGGGACGAGTCTTGCCTGGGTGATCGGCTG       c.900
 E  C  E  K  H  P  R  E  S  D  W  D  E  S  C  L  G  D  R  L         p.300

          .         .         .         .         .         .       g.6517
 AACGGGATTTTGCTGCAACTTATCTCCTGCCTGCAGTGCCGGCGGTGTCCCCACTACTTT       c.960
 N  G  I  L  L  Q  L  I  S  C  L  Q  C  R  R  C  P  H  Y  F         p.320

          .         .         .         .         .         .       g.6577
 CTACCGAACTTAGATCTGTTTCAAGGCAAACCTCACTCAGCTCTGGAAAACGCTGCCAAA       c.1020
 L  P  N  L  D  L  F  Q  G  K  P  H  S  A  L  E  N  A  A  K         p.340

          .         .         .         .         .         .       g.6637
 CAAACGTGGCGACTGGCAAGAGAGATCCTGACCAACCCGAAAAGTTTGGAAAAACTTTAG       c.1080
 Q  T  W  R  L  A  R  E  I  L  T  N  P  K  S  L  E  K  L  X         p.359

          .         .         .         .         .         .       g.6697
 aggatgatttaatcaagagccgaaattattacccttctcaaagtccttattaagtgtaaa       c.*60

          .         .         .         .         .         .       g.6757
 cttctgttcaattcctaatattccactccgcagtgcaaacaatctcttcctttaaaaagg       c.*120

          .         .         .         .         .         .       g.6817
 aataataatacaatatttaaacatcatctcacccacccccacaaggggagaaaaagtagg       c.*180

          .         .         .         .         .         .       g.6877
 ggaagcggatggagaaaaacccaaagccactagtattagaagacttctttccacacgatt       c.*240

          .         .         .         .         .         .       g.6937
 tcctatctcccttgaaaagtacaccgtaacactccgtaaacagcccagctgtaacgccag       c.*300

          .         .         .         .         .         .       g.6997
 accgagacgaacactctgcctaactatcaaaggattatagcaatcctggtgatttaggtg       c.*360

          .         .         .         .         .         .       g.7057
 catctgtctgtgagtaaacacgatttggatatgccatctgaaagaaactgtaatgtatat       c.*420

          .         .         .         .         .         .       g.7117
 tttgatttgtaacaaatattgtgatctcacattgtctttgaaagtgtggatgttggtgtt       c.*480

          .         .         .         .         .         .       g.7177
 ttgtgatttggtgaacagaacttaaattgccattctggatacttccagacattttccact       c.*540

          .         .         .         .         .         .       g.7237
 aacaaagatatcatttaaaggtagatttcttcctggtacttttatctgtctttgaaagtg       c.*600

          .         .         .         .         .         .       g.7297
 tctgaactttaaaaagtttacattttgtttcaaatattgcttgttctatttctaacattc       c.*660

          .         .         .         .         .         .       g.7357
 cataaatatacttgaaatgttatttaaatatattcaaagaaatttgaattcagcttatat       c.*720

          .         .         .         .         .         .       g.7417
 aataacgcttgaatatctgaattatatatttgaaaaatgcacttgaaatacactggataa       c.*780

          .         .         .         .         .         .       g.7477
 ttacttttgtgatttagattttaatttgttgctggtttttatttaattagatggtaataa       c.*840

          .         .         .         .         .         .       g.7537
 atgaagtaaaataaaagttgttgtgtctcactttaaattgtttcctatcacaagatgtaa       c.*900

          .         .         .         .         .         .       g.7597
 tgatgcattttgaaaatcaaacccacttgaatatcttaaatattttgagaaatatgctaa       c.*960

          .         .         .         .         .         .       g.7657
 tgaaatccttaaaaataaaacattggagaaaagctctttctgtataggtccataagataa       c.*1020

          .         .         .         .         .         .       g.7717
 caatctactctcagtctctaacttacttgtaagacaattcctttctacaacagaaacaat       c.*1080

          .         .         .         .         .         .       g.7777
 ttaaatctacctttgaaagcttgctcttcttgtagcatttttgataatataagaaaaaaa       c.*1140

          .         .         .         .         .         .       g.7837
 gtctatcatgacagtagagatgactgagttaaaaatctgactaattcagaggaaatgaac       c.*1200

          .         .         .         .         .         .       g.7897
 ttaacaaagtcataatgaaacttcgaaaattatgtatgaaaactaataaaacgatccttt       c.*1260

          .                                                         g.7907
 ctgaccaata                                                         c.*1270

 (downstream sequence)
Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The Mab-21-like 1 (C. elegans) protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.

Powered by LOVD v.3.0 Build 26c
©2004-2021 Leiden University Medical Center