v-maf musculoaponeurotic fibrosarcoma oncogene homolog B (avian) (MAFB) - coding DNA reference sequence

(used for variant description)

(last modified July 4, 2017)

This file was created to facilitate the description of sequence variants on transcript NM_005461.4 in the MAFB gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_023378.1, covering MAFB transcript NM_005461.4.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
                               .         .         .                g.5026
                               cagcacagctgcaccgccgagctgcgagcg       c.-361

 .         .         .         .         .         .                g.5086
 gctgcgagcgagagagcgtaagagcaagagagctagagagcgagcaacgggcactcgccc       c.-301

 .         .         .         .         .         .                g.5146
 cacgcctcccctcagccccaccgcgcgctccgcttgcctctccaccccgcccgactctac       c.-241

 .         .         .         .         .         .                g.5206
 ccggcccggtccctgcgcgggcacagcccagagctctggggcggtgcaggcagcctcggg       c.-181

 .         .         .         .         .         .                g.5266
 actctccggcgcgccgccgcgtccccagacaaaggcttggccggcggccccggcccgctg       c.-121

 .         .         .         .         .         .                g.5326
 cgccctcgctccccgcctccccagctcttctccgctcttcccccccgcgcttggctcggc       c.-61

 .         .         .         .         .         .                g.5386
 gcgctccggccggccgcaaagtttcccgggcggcagcggcggctgcgcctcgcttcagcg       c.-1

          .         .         .         .         .         .       g.5446
 ATGGCCGCGGAGCTGAGCATGGGGCCAGAGCTGCCCACCAGCCCGCTGGCCATGGAGTAT       c.60
 M  A  A  E  L  S  M  G  P  E  L  P  T  S  P  L  A  M  E  Y         p.20

          .         .         .         .         .         .       g.5506
 GTCAACGACTTCGACCTGCTCAAGTTCGACGTGAAGAAGGAGCCACTGGGGCGCGCGGAG       c.120
 V  N  D  F  D  L  L  K  F  D  V  K  K  E  P  L  G  R  A  E         p.40

          .         .         .         .         .         .       g.5566
 CGTCCGGGCAGGCCCTGCACACGCCTGCAGCCAGCCGGCTCGGTGTCCTCCACACCGCTC       c.180
 R  P  G  R  P  C  T  R  L  Q  P  A  G  S  V  S  S  T  P  L         p.60

          .         .         .         .         .         .       g.5626
 AGCACTCCGTGTAGCTCCGTGCCCTCGTCGCCCAGCTTCAGCCCGACCGAACAGAAGACA       c.240
 S  T  P  C  S  S  V  P  S  S  P  S  F  S  P  T  E  Q  K  T         p.80

          .         .         .         .         .         .       g.5686
 CACCTCGAGGATCTGTACTGGATGGCGAGCAACTACCAGCAGATGAACCCCGAGGCGCTC       c.300
 H  L  E  D  L  Y  W  M  A  S  N  Y  Q  Q  M  N  P  E  A  L         p.100

          .         .         .         .         .         .       g.5746
 AACCTGACGCCCGAGGACGCGGTGGAAGCGCTCATCGGCTCGCACCCAGTGCCACAGCCG       c.360
 N  L  T  P  E  D  A  V  E  A  L  I  G  S  H  P  V  P  Q  P         p.120

          .         .         .         .         .         .       g.5806
 CTGCAAAGCTTCGACAGCTTTCGCGGCGCTCACCACCACCACCATCACCACCACCCTCAC       c.420
 L  Q  S  F  D  S  F  R  G  A  H  H  H  H  H  H  H  H  P  H         p.140

          .         .         .         .         .         .       g.5866
 CCGCACCACGCGTACCCGGGCGCCGGCGTGGCCCACGACGAGCTGGGCCCGCACGCTCAC       c.480
 P  H  H  A  Y  P  G  A  G  V  A  H  D  E  L  G  P  H  A  H         p.160

          .         .         .         .         .         .       g.5926
 CCGCACCATCACCATCATCACCAAGCGTCGCCGCCGCCGTCCAGCGCCGCTAGCCCGGCG       c.540
 P  H  H  H  H  H  H  Q  A  S  P  P  P  S  S  A  A  S  P  A         p.180

          .         .         .         .         .         .       g.5986
 CAACAGCTGCCCACTAGCCACCCCGGGCCCGGGCCGCACGCGACGGCCTCGGCGACGGCG       c.600
 Q  Q  L  P  T  S  H  P  G  P  G  P  H  A  T  A  S  A  T  A         p.200

          .         .         .         .         .         .       g.6046
 GCGGGCGGCAACGGCAGCGTGGAGGACCGCTTCTCCGACGACCAGCTCGTGTCCATGTCC       c.660
 A  G  G  N  G  S  V  E  D  R  F  S  D  D  Q  L  V  S  M  S         p.220

          .         .         .         .         .         .       g.6106
 GTGCGCGAGCTGAACCGCCACCTGCGGGGCTTCACCAAGGACGAGGTGATCCGCCTGAAG       c.720
 V  R  E  L  N  R  H  L  R  G  F  T  K  D  E  V  I  R  L  K         p.240

          .         .         .         .         .         .       g.6166
 CAGAAGCGGCGGACCCTGAAGAACCGGGGCTACGCCCAGTCTTGCAGGTATAAACGCGTC       c.780
 Q  K  R  R  T  L  K  N  R  G  Y  A  Q  S  C  R  Y  K  R  V         p.260

          .         .         .         .         .         .       g.6226
 CAGCAGAAGCACCACCTGGAGAATGAGAAGACGCAGCTCATTCAGCAGGTGGAGCAGCTT       c.840
 Q  Q  K  H  H  L  E  N  E  K  T  Q  L  I  Q  Q  V  E  Q  L         p.280

          .         .         .         .         .         .       g.6286
 AAGCAGGAGGTGTCCCGGCTGGCCCGCGAGAGAGACGCCTACAAGGTCAAGTGCGAGAAA       c.900
 K  Q  E  V  S  R  L  A  R  E  R  D  A  Y  K  V  K  C  E  K         p.300

          .         .         .         .         .         .       g.6346
 CTCGCCAACTCCGGCTTCAGGGAGGCGGGCTCCACCAGCGACAGCCCCTCCTCTCCCGAG       c.960
 L  A  N  S  G  F  R  E  A  G  S  T  S  D  S  P  S  S  P  E         p.320

          .                                                         g.6358
 TTCTTTCTGTGA                                                       c.972
 F  F  L  X                                                         p.323

          .         .         .         .         .         .       g.6418
 gtcgtggccggtcctggcccccgcccttgccccggcccggactccctgtcccacgtccct       c.*60

          .         .         .         .         .         .       g.6478
 agtcccagactaccccggaccctgtccctgccgcggccccagccttgacctgtttgactt       c.*120

          .         .         .         .         .         .       g.6538
 gagcgagagggaggaagggcgcgcgggccgcgggcgacgggcgggtgcgcgggcgggcag       c.*180

          .         .         .         .         .         .       g.6598
 gggaccttggctaaggcgagagtagcgcacgccagcgccgcctcctagactcgagcagag       c.*240

          .         .         .         .         .         .       g.6658
 ccggagagagagacgagagggtgggaggtcccggagtaacttctctccaggctgaagggc       c.*300

          .         .         .         .         .         .       g.6718
 ggcgaggcatagtcccgagaagtcaccaaggccatctggagactcctggctttctgaact       c.*360

          .         .         .         .         .         .       g.6778
 ttgcgcgttaagccgggacagctgctttgctgcccggagagtagtccgcgccaggaagag       c.*420

          .         .         .         .         .         .       g.6838
 agcaacgaggaaaggagagggactctggcgtcccggcaggcgagaggcgaggctgagcga       c.*480

          .         .         .         .         .         .       g.6898
 aagaaggaaggacagacggacctgtctgtcagagttcggagaacactggctctcagccct       c.*540

          .         .         .         .         .         .       g.6958
 gagacacaggcctcagttaggacgctcggcgcccaaatctcatcagttttattgcctgct       c.*600

          .         .         .         .         .         .       g.7018
 cgattatatagaaaaatacaaaaaatctgcattaaaaatattaatcctgcatgctggaca       c.*660

          .         .         .         .         .         .       g.7078
 tgtatggtaataatttctattttgtaccattttcttgtttaactttagcatgttgttgat       c.*720

          .         .         .         .         .         .       g.7138
 catggatcatactccccttgtttctttgggtgagaagggatcgcagtttggaaactccgg       c.*780

          .         .         .         .         .         .       g.7198
 cggctgcgtgcggggtttcagtcccagctgtaggcttgtaaatacccgccccgccaaacc       c.*840

          .         .         .         .         .         .       g.7258
 gcatagagaacgtggcagcaagctgagggtctttgtttgggtttattattacggtatttt       c.*900

          .         .         .         .         .         .       g.7318
 tgtttgtaagttaaaaagaaaaaaaaaaagaaaaagttccgggcattttgcatcagaaaa       c.*960

          .         .         .         .         .         .       g.7378
 caactttgtcttggggcacacttggaagttgcatgttttctttccttcccttatccccat       c.*1020

          .         .         .         .         .         .       g.7438
 tcggtcctctttttcctctctcgctttagttttcaaccttgttggtgctgagagagagaa       c.*1080

          .         .         .         .         .         .       g.7498
 ccgagaggtcccagtacaagggcagggcagggcagggaagctgccaagctccgcacccca       c.*1140

          .         .         .         .         .         .       g.7558
 gaggagtgttctggactacagccttgtcttatggtcaaattgatacccttaataagaaag       c.*1200

          .         .         .         .         .         .       g.7618
 gaaaggaaaggaaaacagatcctcccctctgctttttattgtaaccagaatcaccctgag       c.*1260

          .         .         .         .         .         .       g.7678
 gtcccttctgaaccctctgggcctgcgctaattgtaggagccacagcgctcctagggtga       c.*1320

          .         .         .         .         .         .       g.7738
 gaggcttagccatccctgaccctggcagtgcactggtaagcagacactgcactgaaccaa       c.*1380

          .         .         .         .         .         .       g.7798
 ctgctatgctcagaatgtaccagaaacccaaacattggcaagtaattttgcaactttcaa       c.*1440

          .         .         .         .         .         .       g.7858
 gtgcgttctttagaccaatgcattgcgtttctttccctgcttttgagatagtaggaagag       c.*1500

          .         .         .         .         .         .       g.7918
 ttcttggtggtgtccccccccttcaattcttcagttgtatagtagttatagggaagatat       c.*1560

          .         .         .         .         .         .       g.7978
 gggtgtttttctttattattacttttttttttctgcaggtcagtaaaaggatttaagttg       c.*1620

          .         .         .         .         .         .       g.8038
 cactgacaaaaataccaaaataaaagtgtatttttaagttcccatttgaaattgctggcg       c.*1680

          .         .         .         .         .         .       g.8098
 ctgctggccggatgcatttttgagtttgtattagttgataaattaacagtaataacaaga       c.*1740

          .         .         .         .         .         .       g.8158
 ttgtatgaaccgcatggtgcttgcagttttaaatattgtggatatttgtcctgcatcaga       c.*1800

          .         .         .         .         .         .       g.8218
 aacgagctttggtttttacagattcaactgtgttgaaatcaaacctgccgcaacagaaat       c.*1860

          .         .         .         .         .         .       g.8278
 tgtttttatttcatgtaaaataagggatcaatttcaaaccctgcttatgatatgaaaata       c.*1920

          .         .         .         .         .         .       g.8338
 ttaaaacctagtctattgtagttttattcagactggtttctgttttttggttattaaaat       c.*1980

          .         .         .         .         .                 g.8389
 ggtttcctattttgcttattaaaaccatggaaatggtgtttatttagagga                c.*2031

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The V-maf musculoaponeurotic fibrosarcoma oncogene homolog B (avian) protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.