melanoma antigen family A, 4 (MAGEA4) - coding DNA reference sequence

(used for variant description)

(last modified April 17, 2024)


This file was created to facilitate the description of sequence variants on transcript NM_001011548.1 in the MAGEA4 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NC_000023.10, covering MAGEA4 transcript NM_001011548.1.


Please note that introns are available by clicking on the exon numbers above the sequence.
 (upstream sequence)
                               .         .         .                g.5038
                       agagacaagcgagcttctgcgtctgactcgcagcttga       c.-181

 .         .         .         .         .   | 02     .             g.15581
 gactggcggagggaagcccgcccaggctctataaggagacaag | gttctgagcagacaggc    c.-121

 .         .         .         .         .         .     | 03       g.15716
 caaccggaggacaggattccctggaggccacagaggagcaccaaggagaagatct | gcctg    c.-61

 .         .         .         .         .         .                g.15776
 tgggtccccattgcccagcttttgcctgcactcttgcctgctgccctgaccagagtcatc       c.-1

          .         .         .         .         .         .       g.15836
 ATGTCTTCTGAGCAGAAGAGTCAGCACTGCAAGCCTGAGGAAGGCGTTGAGGCCCAAGAA       c.60
 M  S  S  E  Q  K  S  Q  H  C  K  P  E  E  G  V  E  A  Q  E         p.20

          .         .         .         .         .         .       g.15896
 GAGGCCCTGGGCCTGGTGGGTGCACAGGCTCCTACTACTGAGGAGCAGGAGGCTGCTGTC       c.120
 E  A  L  G  L  V  G  A  Q  A  P  T  T  E  E  Q  E  A  A  V         p.40

          .         .         .         .         .         .       g.15956
 TCCTCCTCCTCTCCTCTGGTCCCTGGCACCCTGGAGGAAGTGCCTGCTGCTGAGTCAGCA       c.180
 S  S  S  S  P  L  V  P  G  T  L  E  E  V  P  A  A  E  S  A         p.60

          .         .         .         .         .         .       g.16016
 GGTCCTCCCCAGAGTCCTCAGGGAGCCTCTGCCTTACCCACTACCATCAGCTTCACTTGC       c.240
 G  P  P  Q  S  P  Q  G  A  S  A  L  P  T  T  I  S  F  T  C         p.80

          .         .         .         .         .         .       g.16076
 TGGAGGCAACCCAATGAGGGTTCCAGCAGCCAAGAAGAGGAGGGGCCAAGCACCTCGCCT       c.300
 W  R  Q  P  N  E  G  S  S  S  Q  E  E  E  G  P  S  T  S  P         p.100

          .         .         .         .         .         .       g.16136
 GACGCAGAGTCCTTGTTCCGAGAAGCACTCAGTAACAAGGTGGATGAGTTGGCTCATTTT       c.360
 D  A  E  S  L  F  R  E  A  L  S  N  K  V  D  E  L  A  H  F         p.120

          .         .         .         .         .         .       g.16196
 CTGCTCCGCAAGTATCGAGCCAAGGAGCTGGTCACAAAGGCAGAAATGCTGGAGAGAGTC       c.420
 L  L  R  K  Y  R  A  K  E  L  V  T  K  A  E  M  L  E  R  V         p.140

          .         .         .         .         .         .       g.16256
 ATCAAAAATTACAAGCGCTGCTTTCCTGTGATCTTCGGCAAAGCCTCCGAGTCCCTGAAG       c.480
 I  K  N  Y  K  R  C  F  P  V  I  F  G  K  A  S  E  S  L  K         p.160

          .         .         .         .         .         .       g.16316
 ATGATCTTTGGCATTGACGTGAAGGAAGTGGACCCCGCCAGCAACACCTACACCCTTGTC       c.540
 M  I  F  G  I  D  V  K  E  V  D  P  A  S  N  T  Y  T  L  V         p.180

          .         .         .         .         .         .       g.16376
 ACCTGCCTGGGCCTTTCCTATGATGGCCTGCTGGGTAATAATCAGATCTTTCCCAAGACA       c.600
 T  C  L  G  L  S  Y  D  G  L  L  G  N  N  Q  I  F  P  K  T         p.200

          .         .         .         .         .         .       g.16436
 GGCCTTCTGATAATCGTCCTGGGCACAATTGCAATGGAGGGCGACAGCGCCTCTGAGGAG       c.660
 G  L  L  I  I  V  L  G  T  I  A  M  E  G  D  S  A  S  E  E         p.220

          .         .         .         .         .         .       g.16496
 GAAATCTGGGAGGAGCTGGGTGTGATGGGGGTGTATGATGGGAGGGAGCACACTGTCTAT       c.720
 E  I  W  E  E  L  G  V  M  G  V  Y  D  G  R  E  H  T  V  Y         p.240

          .         .         .         .         .         .       g.16556
 GGGGAGCCCAGGAAACTGCTCACCCAAGATTGGGTGCAGGAAAACTACCTGGAGTACCGG       c.780
 G  E  P  R  K  L  L  T  Q  D  W  V  Q  E  N  Y  L  E  Y  R         p.260

          .         .         .         .         .         .       g.16616
 CAGGTACCCGGCAGTAATCCTGCGCGCTATGAGTTCCTGTGGGGTCCAAGGGCTCTGGCT       c.840
 Q  V  P  G  S  N  P  A  R  Y  E  F  L  W  G  P  R  A  L  A         p.280

          .         .         .         .         .         .       g.16676
 GAAACCAGCTATGTGAAAGTCCTGGAGCATGTGGTCAGGGTCAATGCAAGAGTTCGCATT       c.900
 E  T  S  Y  V  K  V  L  E  H  V  V  R  V  N  A  R  V  R  I         p.300

          .         .         .         .         .                 g.16730
 GCCTACCCATCCCTGCGTGAAGCAGCTTTGTTAGAGGAGGAAGAGGGAGTCTGA             c.954
 A  Y  P  S  L  R  E  A  A  L  L  E  E  E  E  G  V  X               p.317

          .         .         .         .         .         .       g.16790
 gcatgagttgcagccagggctgtggggaaggggcagggctgggccagtgcatctaacagc       c.*60

          .         .         .         .         .         .       g.16850
 cctgtgcagcagcttcccttgcctcgtgtaacatgaggcccattcttcactctgtttgaa       c.*120

          .         .         .         .         .         .       g.16910
 gaaaatagtcagtgttcttagtagtgggtttctattttgttggatgacttggagatttat       c.*180

          .         .         .         .         .         .       g.16970
 ctctgtttccttttacaattgttgaaatgttccttttaatggatggttgaattaacttca       c.*240

          .         .         .         .         .         .       g.17030
 gcatccaagtttatgaatcgtagttaacgtatattgctgttaatatagtttaggagtaag       c.*300

          .         .         .         .         .         .       g.17090
 agtcttgttttttattcagattgggaaatccgttctattttgtgaatttgggacataata       c.*360

          .         .         .         .         .         .       g.17150
 acagcagtggagtaagtatttagaagtgtgaattcaccgtgaaataggtgagataaatta       c.*420

          .         .         .         .         .         .       g.17210
 aaagatacttaattcccgccttatgcctcagtctattctgtaaaatttaaaaaatatata       c.*480

          .         .         .         .         .         .       g.17270
 tgcatacctggatttccttggcttcgtgaatgtaagagaaattaaatctgaataaataat       c.*540

          .                                                         g.17282
 tctttctgttaa                                                       c.*552

 (downstream sequence)
Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The Melanoma antigen family A, 4 protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.

Powered by LOVD v.3.0 Build 29b
©2004-2024 Leiden University Medical Center