MAP7 domain containing 3 (MAP7D3) - coding DNA reference sequence

(used for variant description)

(last modified August 17, 2018)


This file was created to facilitate the description of sequence variants on transcript NM_024597.3 in the MAP7D3 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_016801.1, covering MAP7D3 transcript NM_024597.3.


Please note that introns are available by clicking on the exon numbers above the sequence.
 (upstream sequence)
                     .         .         .         .                g.9944
                    agaccaggtagtcgctgcccagccggtcaggacgtgggacg       c.-181

 .         .         .         .         .         .                g.10004
 caaggggcaatcctgcccggttcgcaggtccgaggcgggcgcggtggcccttcgggcccc       c.-121

 .         .         .         .         .         .                g.10064
 gccccgccccgccccgccccgccccgcccaccggcagcccggccacgacccaagcggagg       c.-61

 .         .         .         .         .         .                g.10124
 ccgcgccgacgcctgcgcaatgtatgcggagagccaccaccgcctccggtcccgactccg       c.-1

          .         .         .         .         .         .       g.10184
 ATGATGGCGGACGGCGCCGCAGCTGGCGCTGGCGGCAGCCCATCCTTGAGAGAGCTGCGG       c.60
 M  M  A  D  G  A  A  A  G  A  G  G  S  P  S  L  R  E  L  R         p.20

          . | 02       .         .         .         .         .    g.15191
 GCACGGATGG | TTGCTGCAGCAAACGAGATTGCTAAGGAAAGGAGGAAGCAAGATGTGGTT    c.120
 A  R  M  V |   A  A  A  N  E  I  A  K  E  R  R  K  Q  D  V  V      p.40

          .         .         .         .          | 03        .    g.15345
 AATCGTGTTGCAACCCATTCCTCAAATATAAGATCGACATTTAAACCAG | TAATCGATGGA    c.180
 N  R  V  A  T  H  S  S  N  I  R  S  T  F  K  P  V |   I  D  G      p.60

          .         .         .         .         .         .       g.15405
 TCCATGCTTAAAAATGACATAAAACAAAGATTAGCAAGAGAGCGCAGAGAGGAGAAAAGG       c.240
 S  M  L  K  N  D  I  K  Q  R  L  A  R  E  R  R  E  E  K  R         p.80

          .    | 04    .         .         .         .         .    g.16734
 AGACAGCAAGACG | CCAATAAAGAAACACAACTACTTGAAAAAGAAAGAAAGACCAAGCTC    c.300
 R  Q  Q  D  A |   N  K  E  T  Q  L  L  E  K  E  R  K  T  K  L      p.100

          .         .         .         .         .         .       g.16794
 CAATATGAAAAACAGATGGAGGAAAGACAGAGAAAGCTGAAGGAGCGAAAAGAGAAAGAA       c.360
 Q  Y  E  K  Q  M  E  E  R  Q  R  K  L  K  E  R  K  E  K  E         p.120

          .         .         .         .         .        | 05.    g.20208
 GAACAACGGAGAATAGCTGCAGAAGAAAAAAGACACCAGAAGGATGAAGCACAAAAG | GAA    c.420
 E  Q  R  R  I  A  A  E  E  K  R  H  Q  K  D  E  A  Q  K   | E      p.140

          .         .         .         .         .         .       g.20268
 AAATTTACAGCCATTCTTTATCGTACTTTGGAACGGAGGAGACTTGCTGATGATTATCAG       c.480
 K  F  T  A  I  L  Y  R  T  L  E  R  R  R  L  A  D  D  Y  Q         p.160

          .         .         .         .         .      | 06  .    g.21001
 CAAAAAAGATGGTCATGGGGAGGCTCTGCAATGGCGAATTCTGAGAGCAAAACTG | CCAAT    c.540
 Q  K  R  W  S  W  G  G  S  A  M  A  N  S  E  S  K  T  A |   N      p.180

          .         .         .         .         .         .       g.21061
 AAACGATCTGCATCTACTGAAAAACTTGAACAGGGTACTTCTGCTTTAATCAGACAAATG       c.600
 K  R  S  A  S  T  E  K  L  E  Q  G  T  S  A  L  I  R  Q  M         p.200

          .         .         .         . | 07       .         .    g.25163
 CCTTTGTCATCTGCAGGCCTTCAAAATTCCGTTGCCAAAA | GGAAAACAGACAAGGAGAGA    c.660
 P  L  S  S  A  G  L  Q  N  S  V  A  K  R |   K  T  D  K  E  R      p.220

          .         .         .         .         .         .       g.25223
 AGCTCATCTTTAAATAGAAGAGATAGTAACCTACATTCGTCTACTGATAAAGAACAAGCC       c.720
 S  S  S  L  N  R  R  D  S  N  L  H  S  S  T  D  K  E  Q  A         p.240

          .       | 08 .         .         .         .         .    g.29306
 GAAAGGAAGCCACGTG | TTACAGGCGTCACCAATTATGTAATGCAGTATGTCACTGTACCC    c.780
 E  R  K  P  R  V |   T  G  V  T  N  Y  V  M  Q  Y  V  T  V  P      p.260

          .         .         .         .         .         .       g.29366
 TTGCGTAAATGTACTAGCGACGAATTGAGGGCTGTTATGTTTCCCATGTCGACAATGAAA       c.840
 L  R  K  C  T  S  D  E  L  R  A  V  M  F  P  M  S  T  M  K         p.280

          .         .         .         .         .         .       g.29426
 ATACCTCCTCAAACAAAAGTAGAAGAGTCTCCCTTGGAGAAAGTAGAGACACCTCCCAAG       c.900
 I  P  P  Q  T  K  V  E  E  S  P  L  E  K  V  E  T  P  P  K         p.300

          .         .         .         .         .         .       g.29486
 GCAAGTGTGGATGCACCCCCCCAGGTGAATGTGGAAGTATTCTGCAACACAAGCATGGAA       c.960
 A  S  V  D  A  P  P  Q  V  N  V  E  V  F  C  N  T  S  M  E         p.320

          .         .         .         .         .         .       g.29546
 GCGTCCCCCAAGGCAGGTGTGGGCATGGCCCCTGAGGTGAGCACGGACTCATTCCCTGTG       c.1020
 A  S  P  K  A  G  V  G  M  A  P  E  V  S  T  D  S  F  P  V         p.340

          .         .         .         .         .         .       g.29606
 GTGAGCGTGGACGTGTCGCCTGTGGTGAGCACATATGATTCTGAGATGAGCATGGACGCA       c.1080
 V  S  V  D  V  S  P  V  V  S  T  Y  D  S  E  M  S  M  D  A         p.360

          .         .         .         .         .         .       g.29666
 TCCCCCGAGTTGAGCATAGAAGCACTCCCGAAGGTGGACCTGGAAACAGTTCCCAAGGTG       c.1140
 S  P  E  L  S  I  E  A  L  P  K  V  D  L  E  T  V  P  K  V         p.380

          .         .         .         .         .         .       g.29726
 AGCATAGTAGCATCCCCGGAGGCGAGCCTGGAAGCACCCCCGGAAGTGAGTCTGGAAGCA       c.1200
 S  I  V  A  S  P  E  A  S  L  E  A  P  P  E  V  S  L  E  A         p.400

          .         .         .         .         .         .       g.29786
 CTGCCAGAGGTGAGCGTGGAAGCAGCCCCAGAGGGGAGCCTGGAAGCACCTCCCAAGGGG       c.1260
 L  P  E  V  S  V  E  A  A  P  E  G  S  L  E  A  P  P  K  G         p.420

          .         .         .         .         .         .       g.29846
 AGCGCAGAAGTAGCCCCCAAGGAGAGTGTGAAAGGGTCACCCAAGGAGAGCATGGAGGCA       c.1320
 S  A  E  V  A  P  K  E  S  V  K  G  S  P  K  E  S  M  E  A         p.440

          .         .         .         .         .         .       g.29906
 TCTCCTGAGGCGATGGTGAAAGCATCCCCCAAGACATCCCTTGAAGCAAGCATGGAAGCA       c.1380
 S  P  E  A  M  V  K  A  S  P  K  T  S  L  E  A  S  M  E  A         p.460

          .         .         .    | 09    .         .         .    g.30543
 TCTCCCAAGGCAAAAGCGAGAGACGCTCCAAAG | AAATCAGAAATGGACAAACAGGCCTTA    c.1440
 S  P  K  A  K  A  R  D  A  P  K   | K  S  E  M  D  K  Q  A  L      p.480

          .         .         .         .         .         .       g.30603
 ATCCCTATTGCCAAGAAGCGTCTATCATCATACACTGAGTGTTATAAATGGTCATCATCT       c.1500
 I  P  I  A  K  K  R  L  S  S  Y  T  E  C  Y  K  W  S  S  S         p.500

          .         .         .         .  | 10      .         .    g.30908
 CCTGAAAATGCTTGTGGTCTGCCGTCTCCCATCAGCACTAA | CAGGCAAATCCAAAAGAAC    c.1560
 P  E  N  A  C  G  L  P  S  P  I  S  T  N  |  R  Q  I  Q  K  N      p.520

          .         .         .         .         .         .       g.30968
 TGCCCTCCATCACCATTACCACTTATTTCAAAACAGTCACCACAGACTTCTTTTCCTTAT       c.1620
 C  P  P  S  P  L  P  L  I  S  K  Q  S  P  Q  T  S  F  P  Y         p.540

          .         .         .         .         .         .       g.31028
 AAAATAATGCCTATTCAACACACCCTGTCTGTGCAAAGTGCATCAAGTACTGTCAAAAAG       c.1680
 K  I  M  P  I  Q  H  T  L  S  V  Q  S  A  S  S  T  V  K  K         p.560

          .         .         .         .         .         .       g.31088
 AAAAAAGAAACAGTTTCTAAAACCACTAACAGATGTGAGGCTTTGAGCCAAAGGCATATG       c.1740
 K  K  E  T  V  S  K  T  T  N  R  C  E  A  L  S  Q  R  H  M         p.580

          . | 11       .         .         .         .         .    g.32774
 ATCTATGAAG | AGTCTGGTAATAAGAGTACTGCAGGTATTATGAATGCCGAGGCGGCAACA    c.1800
 I  Y  E  E |   S  G  N  K  S  T  A  G  I  M  N  A  E  A  A  T      p.600

          .         .         .         .         .         .       g.32834
 AAAATTTTGACAGAATTGCGCCGCCTTGCTCGTGAACAAAGAGAAAAAGAGGAAGAAGAA       c.1860
 K  I  L  T  E  L  R  R  L  A  R  E  Q  R  E  K  E  E  E  E         p.620

          .         .       | 12 .         .         .         .    g.34085
 AGACAACGGGAAGAAATGCAGCAAAG | GGTCATTAAGAAATCAAAAGACATGGCAAAGGAA    c.1920
 R  Q  R  E  E  M  Q  Q  R  |  V  I  K  K  S  K  D  M  A  K  E      p.640

          .         .         .         .         .         .       g.34145
 GCAGTTGGAGGCCAAGCAGAAGACCACTTGAAACTCAAAGATGGGCAGCAACAAAATGAG       c.1980
 A  V  G  G  Q  A  E  D  H  L  K  L  K  D  G  Q  Q  Q  N  E         p.660

          .         .         .         .         .     | 13   .    g.35475
 ACTAAAAAGAAGAAAGGATGGCTGGATCAGGAAGACCAGGAAGCACCACTGCAG | AAAGGG    c.2040
 T  K  K  K  K  G  W  L  D  Q  E  D  Q  E  A  P  L  Q   | K  G      p.680

          .         .         .         .         .         .       g.35535
 GACGCCAAAATAAAAGCTCAAGAGGAAGCTGACAAACGCAAGAAAGAACACGAGAGAATT       c.2100
 D  A  K  I  K  A  Q  E  E  A  D  K  R  K  K  E  H  E  R  I         p.700

          .         .         .          | 14        .         .    g.36623
 ATGTTACAAAATTTACAAGAACGGTTAGAAAGGAAAAAG | AGAATAGAAGAAATTATGAAG    c.2160
 M  L  Q  N  L  Q  E  R  L  E  R  K  K   | R  I  E  E  I  M  K      p.720

          .         .         .    | 15    .         .         .    g.39023
 CGGACAAGAAAGACAGATGTGAATGCCTCAAAG | GTCACAGAAACATCCAGCCATGACATA    c.2220
 R  T  R  K  T  D  V  N  A  S  K   | V  T  E  T  S  S  H  D  I      p.740

          .         .         .         .         .         .       g.39083
 TATGAAGAGGCTGAGGCTGACAACGAAGAAAGCGACAAGGACTCATTGAATGAAATGTTT       c.2280
 Y  E  E  A  E  A  D  N  E  E  S  D  K  D  S  L  N  E  M  F         p.760

         | 16.         .         .         .         .         .    g.40572
 CCATCAG | CCATTCTAAATGGCACAGGCTCACCTACCAAATTTAAAATGCCGTTCAACAAT    c.2340
 P  S  A |   I  L  N  G  T  G  S  P  T  K  F  K  M  P  F  N  N      p.780

          .         .         .         .         .         .       g.40632
 GCCAAGAAAATGACACACAAGCTGGTATTTCTAGAAGATGGTACCAGCCAGGTCCGTAAA       c.2400
 A  K  K  M  T  H  K  L  V  F  L  E  D  G  T  S  Q  V  R  K         p.800

          .         .         .         .         .         .       g.40692
 GAGCCAAAAACATATTTTAATGGCGATTTGAAAAACTTCAGACAAAAAAGCATGAAAGAC       c.2460
 E  P  K  T  Y  F  N  G  D  L  K  N  F  R  Q  K  S  M  K  D         p.820

          .         .       | 17 .         .         .         .    g.41845
 ACTTCAATACAGGAAGTAGTTTCAAG | ACCATCTTCCAAAAGAATGACCAGTCACACAACG    c.2520
 T  S  I  Q  E  V  V  S  R  |  P  S  S  K  R  M  T  S  H  T  T      p.840

          .         .         .         .      | 18  .         .    g.42002
 AAAACCAGAAAGGCGGATGAAACCAACACCACCAGCAGATCCTCT | GCACAAACAAAATCT    c.2580
 K  T  R  K  A  D  E  T  N  T  T  S  R  S  S   | A  Q  T  K  S      p.860

          .         .         .         .         .                 g.42053
 GAAGGATTCCATGACATCTTGCCAAAGTCCTCAGACACCTTTAGACAATAA                c.2631
 E  G  F  H  D  I  L  P  K  S  S  D  T  F  R  Q  X                  p.876

          .         .         .   | 19     .         .         .    g.43017
 gagaagaagcaaacctgtttctcctcatttgg | atatgtaaaccttactcagcctgggaga    c.*60

          .         .         .         .         .         .       g.43077
 tgaatacatcttccactctggataactcaactcctgggcccatcagtcctcaaatttttc       c.*120

          .         .         .         .         .         .       g.43137
 tgcttctgacttgaacctggtaaaggaagtgacaccgaaaaattgaaagaaactgtcaaa       c.*180

          .         .         .         .         .         .       g.43197
 aggccactttgatgtatatctcagatgttaaagtcatcttattctcttgtgtctaagcaa       c.*240

          .         .         .         .         .         .       g.43257
 gagttctaagtaaagagtggtttttgttttctttggaaaatcatcattgtctctcattct       c.*300

          .         .         .         .         .         .       g.43317
 tgtgttgtcccaccaatgtgtttgctggagtgagtgcatcaaggatgctttcctgaaact       c.*360

          .         .         .         .         .         .       g.43377
 gtaactgtggagtttctagaagaatctgattgcagaactaattctctttcagtatatatt       c.*420

          .         .         .         .         .         .       g.43437
 tgaaatcttaaagtaatgctttttctttttctttttcttttttttttttttgagacggag       c.*480

          .         .         .         .         .         .       g.43497
 tcttgccctgtcgcccaggctgcagtgcagtggcacaatctcggctcactgcaacctccg       c.*540

          .         .         .         .         .         .       g.43557
 cctcctcatctcaagcaattctcctgtctcagcctccccagtagctgggattacaggcat       c.*600

          .         .         .         .         .         .       g.43617
 gtgccaccacacctggctaatttttttgtattttagtagagatagggttttaccatgttc       c.*660

          .         .         .         .         .         .       g.43677
 accaggctagtctcgaaatcctggcctcaagagatccacccgtcttggcctcccaaagtg       c.*720

          .         .         .         .         .         .       g.43737
 ttgggattacaggtgtgagccactgcacccagccaagtaatgctttttctgtgtaccagt       c.*780

          .         .         .         .         .         .       g.43797
 gacaattttgacagctaaaaactcacagttgatcttgtagagaacagaatagattatgca       c.*840

          .         .         .         .         .         .       g.43857
 agggccgcaggatcgctcacaagagctgtcagattgtttctaatataaaaataccaaagg       c.*900

          .         .         .         .         .         .       g.43917
 ttgcaaaatccagcaaattgtattttactgtgatatatgtatatttttaactctacccat       c.*960

          .         .         .         .         .         .       g.43977
 ctgtgccagtgagtacacaggcactaataacctgaaatgctgggagtcctgtaaagcccc       c.*1020

          .         .         .         .         .         .       g.44037
 atcttggaacagtcagcacctttcatgctcttgtcagtgtttccttttgaaggacatatt       c.*1080

          .         .         .         .         .         .       g.44097
 ggtgtttatctacagaaacatatattatttttattgtgtacataaaggagtatatggctg       c.*1140

          .         .         .         .         .         .       g.44157
 ttgtcccgtggggtatgtttaattcctctaaatgtttaaagtacttttctgcctgtactc       c.*1200

          .         .         .         .         .         .       g.44217
 tccagttctgtcgttgagtatacactcaggcttgagatacaaccaaaatttgcttgcctt       c.*1260

          .         .         .         .         .         .       g.44277
 tctctagccactggctgccagtgagttcgtgtgatgggcacacagaaatgcacacagatg       c.*1320

          .         .         .         .         .         .       g.44337
 tacatacacgtatgtatgcacacacagtatatgattccataaaattcaaatgcagattaa       c.*1380

          .         .         .         .         .         .       g.44397
 ttctcctaatgagttttcagtgttgaatcgtaaatagtctgaagcaggccagtgttcctt       c.*1440

          .         .         .         .         .         .       g.44457
 ttggctgccagtcttggattagtaaaaggaggtaattctttcagattccctggttctttg       c.*1500

          .         .         .         .         .         .       g.44517
 ccactcagagtattgtacttttgatatagaatagagaaggttacctttggtttaaaaact       c.*1560

          .         .         .         .         .         .       g.44577
 atttttatatactagctctttcatgtataaaacagagacaatcatcctaacaaaagagtt       c.*1620

          .         .         .         .         .         .       g.44637
 cctgttatttttctgcacaaatgtcttgtgttgaaacactgttacagttccatataaatg       c.*1680

          .         .         .                                     g.44669
 tgtgctatataaaataaactttggagataaaa                                   c.*1712

 (downstream sequence)
Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The MAP7 domain containing 3 protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.

Powered by LOVD v.3.0 Build 21
©2004-2018 Leiden University Medical Center