membrane-bound transcription factor peptidase, site 2 (MBTPS2) - coding DNA reference sequence

(used for variant description)

(last modified May 18, 2017)


This file was created to facilitate the description of sequence variants on transcript NM_015884.3 in the MBTPS2 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_012797.1, covering MBTPS2 transcript NM_015884.3.


Please note that introns are available by clicking on the exon numbers above the sequence.
 (upstream sequence)
                                                   .                g.5017
                                            ttccggtactagcaaat       c.-181

 .         .         .         .         .         .                g.5077
 cctcctgtatgtccccactggaagagtccggtgggaaaccgtgccaccgcaaggaaggag       c.-121

 .         .         .         .         .         .                g.5137
 ccggcggtagcttggttcctgagcggatgctggggctgtaaggcgcgcgcggtcagctgt       c.-61

 .         .         .         .         .         .                g.5197
 tggcggtgcagggaggaggacgccggggctcgccttccctcctctgccgccgctgccgcc       c.-1

          .         .         .         .         .         .       g.5257
 ATGATTCCGGTGTCGCTGGTGGTGGTGGTGGTGGGTGGCTGGACTGTCGTCTACCTGACC       c.60
 M  I  P  V  S  L  V  V  V  V  V  G  G  W  T  V  V  Y  L  T         p.20

          .      | 02  .         .         .         .         .    g.8677
 GACTTGGTGCTGAAG | TCATCTGTCTATTTTAAACATTCTTATGAAGACTGGCTGGAAAAC    c.120
 D  L  V  L  K   | S  S  V  Y  F  K  H  S  Y  E  D  W  L  E  N      p.40

          .         .         .         .         .         .       g.8737
 AACGGACTGAGCATCTCCCCTTTCCACATAAGATGGCAAACTGCTGTTTTCAATCGTGCC       c.180
 N  G  L  S  I  S  P  F  H  I  R  W  Q  T  A  V  F  N  R  A         p.60

          .         .         .         .     | 03   .         .    g.10649
 TTTTACAGTTGGGGACGGCGGAAAGCAAGGATGCTTTACCAATG | GTTCAATTTTGGAATG    c.240
 F  Y  S  W  G  R  R  K  A  R  M  L  Y  Q  W  |  F  N  F  G  M      p.80

          .         .         .         .         .         .       g.10709
 GTGTTTGGCGTAATTGCCATGTTTAGCTCATTTTTTCTCCTTGGAAAAACGCTGATGCAG       c.300
 V  F  G  V  I  A  M  F  S  S  F  F  L  L  G  K  T  L  M  Q         p.100

          .         .         .         .         .         .       g.10769
 ACTTTGGCACAAATGATGGCTGACTCTCCCTCTTCTTATTCTTCCTCCTCTTCTTCCTCT       c.360
 T  L  A  Q  M  M  A  D  S  P  S  S  Y  S  S  S  S  S  S  S         p.120

          .         .         .         .         .         .       g.10829
 TCCTCCTCTTCTTCCTCTTCCTCTTCTTCATCTTCTTCCTCTTCCTCGCTTCACAATGAA       c.420
 S  S  S  S  S  S  S  S  S  S  S  S  S  S  S  S  L  H  N  E         p.140

          .         | 04         .         .         .         .    g.17013
 CAGGTGTTACAAGTTGTG | GTTCCTGGTATAAATTTACCCGTCAATCAACTGACCTATTTC    c.480
 Q  V  L  Q  V  V   | V  P  G  I  N  L  P  V  N  Q  L  T  Y  F      p.160

          .         .         .         .         .         .       g.17073
 TTCACGGCAGTTCTCATTAGTGGTGTTGTACATGAAATTGGACATGGGATAGCAGCTATT       c.540
 F  T  A  V  L  I  S  G  V  V  H  E  I  G  H  G  I  A  A  I         p.180

    | 05     .         .         .         .         .         .    g.18896
 AG | GGAACAAGTTCGATTTAATGGCTTTGGGATTTTTCTCTTCATTATTTATCCTGGAGCA    c.600
 R  |  E  Q  V  R  F  N  G  F  G  I  F  L  F  I  I  Y  P  G  A      p.200

          .         .         .         .         .         .       g.18956
 TTTGTTGATCTGTTCACCACTCATTTGCAACTTATATCGCCAGTCCAGCAGCTAAGGATA       c.660
 F  V  D  L  F  T  T  H  L  Q  L  I  S  P  V  Q  Q  L  R  I         p.220

          . | 06       .         .         .         .         .    g.33979
 TTTTGTGCAG | GTATCTGGCATAATTTTGTCCTTGCACTCTTGGGTATTTTAGCTCTTGTT    c.720
 F  C  A  G |   I  W  H  N  F  V  L  A  L  L  G  I  L  A  L  V      p.240

          .         .         .         .         .         .       g.34039
 CTCCTCCCAGTAATTCTCTTGCCATTTTACTACACTGGAGTTGGGGTGCTCATCACTGAA       c.780
 L  L  P  V  I  L  L  P  F  Y  Y  T  G  V  G  V  L  I  T  E         p.260

           | 07        .         .         .         .         .    g.35011
 GTTGCTGAG | GACTCTCCTGCCATTGGACCCAGAGGCCTTTTTGTGGGAGACCTTGTCACC    c.840
 V  A  E   | D  S  P  A  I  G  P  R  G  L  F  V  G  D  L  V  T      p.280

          .         .         .         .         .         .       g.35071
 CATCTACAGGATTGTCCTGTTACTAATGTGCAAGATTGGAATGAATGTTTAGATACCATC       c.900
 H  L  Q  D  C  P  V  T  N  V  Q  D  W  N  E  C  L  D  T  I         p.300

          .         .         .         .         .         .       g.35131
 GCCTATGAGCCCCAAATTGGTTACTGTATAAGTGCATCAACTTTACAGCAGTTAAGTTTC       c.960
 A  Y  E  P  Q  I  G  Y  C  I  S  A  S  T  L  Q  Q  L  S  F         p.320

          . | 08       .         .         .         .         .    g.43554
 CCAGTTAGAG | CATACAAACGACTAGATGGTTCAACTGAATGCTGTAACAATCACAGCCTC    c.1020
 P  V  R  A |   Y  K  R  L  D  G  S  T  E  C  C  N  N  H  S  L      p.340

          .         .         .         .      | 09  .         .    g.43974
 ACAGATGTGTGCTTTTCCTACAGAAATAATTTTAATAAGCGTTTG | CATACATGTCTTCCT    c.1080
 T  D  V  C  F  S  Y  R  N  N  F  N  K  R  L   | H  T  C  L  P      p.360

          .         .         .         .         .         .       g.44034
 GCCCGGAAAGCAGTTGAAGCAACTCAAGTTTGCAGAACCAATAAAGACTGTAAAAAAAGC       c.1140
 A  R  K  A  V  E  A  T  Q  V  C  R  T  N  K  D  C  K  K  S         p.380

          .         .         .         .         .         .       g.44094
 TCAAGTTCAAGTTTCTGTATAATACCTTCTTTGGAAACTCACACTCGCTTAATAAAAGTA       c.1200
 S  S  S  S  F  C  I  I  P  S  L  E  T  H  T  R  L  I  K  V         p.400

          .         .         .         .         .         .       g.44154
 AAACACCCACCTCAGATTGATATGTTATACGTAGGACATCCTCTGCATCTTCACTACACA       c.1260
 K  H  P  P  Q  I  D  M  L  Y  V  G  H  P  L  H  L  H  Y  T         p.420

   | 10      .         .         .         .         .         .    g.46418
 G | TGAGCATCACCAGTTTTATCCCACGTTTTAACTTTCTAAGCATAGATCTGCCAGTGGTT    c.1320
 V |   S  I  T  S  F  I  P  R  F  N  F  L  S  I  D  L  P  V  V      p.440

          .        | 11.         .         .         .         .    g.47938
 GTGGAGACATTTGTCAA | GTACCTGATTTCCCTCTCAGGAGCTCTGGCTATTGTTAATGCA    c.1380
 V  E  T  F  V  K  |  Y  L  I  S  L  S  G  A  L  A  I  V  N  A      p.460

          .         .         .         .         .         .       g.47998
 GTACCCTGCTTTGCTTTGGATGGACAATGGATTCTAAACTCTTTCTTGGATGCCACCCTT       c.1440
 V  P  C  F  A  L  D  G  Q  W  I  L  N  S  F  L  D  A  T  L         p.480

          .         .         .         .         .         .       g.48058
 ACCTCAGTGATTGGAGACAATGATGTCAAAGATCTAATAGGGTTTTTCATCTTGCTGGGT       c.1500
 T  S  V  I  G  D  N  D  V  K  D  L  I  G  F  F  I  L  L  G         p.500

          .         .         .         .         .         .       g.48118
 GGCAGTGTACTTTTGGCTGCCAATGTGACCCTGGGACTCTGGATGGTTACAGCACGGTAA       c.1560
 G  S  V  L  L  A  A  N  V  T  L  G  L  W  M  V  T  A  R  X         p.519

          .         .         .         .         .         .       g.48178
 tgtttgcactcatctgacagaatccctgagttacagtatacagctatgtggtaatattca       c.*60

          .         .         .         .         .         .       g.48238
 ttgccattgaaattcttacttggtatgaaatataaagtgtttccttaaaattacatctta       c.*120

          .         .         .         .         .         .       g.48298
 gccaacaaccctgagctcctcccatatccagagtacccaaactctgtggtagaagataag       c.*180

          .         .         .         .         .         .       g.48358
 cagaagaaatgaaaggcatagtccctgactatattctaatttaggactgaatgtacccag       c.*240

          .         .         .         .         .         .       g.48418
 atgcttgtggaataatatctaagcaagtgcaaattcatgtaataccgttttgtctgatta       c.*300

          .         .         .         .         .         .       g.48478
 catattgtgttgaaatagtataaaggagaacagaactgggtggaattaattgggaaaaac       c.*360

          .         .         .         .         .         .       g.48538
 ttcttacaaaagcatcattaatcaaaatttgaaggagaccagactttggccaagtggaag       c.*420

          .         .         .         .         .         .       g.48598
 gatgaccattgtcttggcctgtatctcttgtcctttgtcttgtttgaaaagtattttaaa       c.*480

          .         .         .         .         .         .       g.48658
 acttaatggtgtattattttgtgctctgaaagctgaggtctgattacaattagtaaaatt       c.*540

          .         .         .         .         .         .       g.48718
 ctatagaagaatctgctgacgtgaaagggaaaaatctttgtcaaatgataccaaataaat       c.*600

          .         .         .         .         .         .       g.48778
 gaacaaaacaggaagtagggcctatgatatcgtgagacatgttttgccccacaagagttg       c.*660

          .         .         .         .         .         .       g.48838
 catcttttataaggtgtctctgccccctcataaagcagcactagctttgacatccacggt       c.*720

          .         .         .         .         .         .       g.48898
 gagctgcaggaagcatcacacaccagcagcatgtgagcagagggaggcagttggggttga       c.*780

          .         .         .         .         .         .       g.48958
 acttcggaactaggccgggtctcctgacagatcacaagacaccccagaggatcttcagca       c.*840

          .         .         .         .         .         .       g.49018
 gtcctacttcccattctctatagagctttgaagcttggaacccttccagggtaaacattt       c.*900

          .         .         .         .         .         .       g.49078
 tctcttgtgctgctcaggacatctggggcctagctcctgggttcctgtctccaagaagca       c.*960

          .         .         .         .         .         .       g.49138
 atgaccttaaactctgagccatactctgtcctcaccagcggctcccatgtttttctgtgt       c.*1020

          .         .         .         .         .         .       g.49198
 caggttattaagtacctagtccttgttttctgtctctctcctaagctacctctctgggtc       c.*1080

          .         .         .         .         .         .       g.49258
 cacagaagacttggtagtatagtgagaatggctatacgtgagtacaaacgtggattttcc       c.*1140

          .         .         .         .         .         .       g.49318
 agggcttgggaactgattcttgagcccagaagagccacgcctgctttgaggtcttttgga       c.*1200

          .         .         .         .         .         .       g.49378
 gtggagatgcagccctgggaaatttggggagtcagcaggccagtgtgaagctattggtcc       c.*1260

          .         .         .         .         .         .       g.49438
 taggagtatatgagcttgctgtttctttgatggaaaatacatgcttctcttgtatactca       c.*1320

          .         .         .         .         .         .       g.49498
 gaagtgactaagggcaataactcattaatagccatctatccaacttctttactgagtgat       c.*1380

          .         .         .         .         .         .       g.49558
 gtattccatggggttacctttttcagattattgagttgctctgtaagcactaaaactttt       c.*1440

          .         .         .         .         .         .       g.49618
 taatcatttttaagaaactttttagattgtattacaaatttgccttaacagtaattagat       c.*1500

          .         .         .         .         .         .       g.49678
 gttgaatataattttaacattttattaatgacttgggtcatcagttaataccagtactaa       c.*1560

          .         .         .         .         .         .       g.49738
 aaccatacgaattattggtttattccagaaaatacagtatttgttctatttttaggtaga       c.*1620

          .         .         .         .         .         .       g.49798
 caatcatttgggatcagagtacattagcatagtaatgctcagtcagacctgttcaagtag       c.*1680

          .         .         .         .         .         .       g.49858
 tagagcttggagaatgccatgaaatacttatataattaatttgattgcatgaactaagca       c.*1740

          .         .         .         .         .         .       g.49918
 attttactaatgaaaaggttgtatatgtgcaagtcacttttttaaaaaccaagaaaaaac       c.*1800

          .         .         .         .         .         .       g.49978
 tttaatagaggaaatcttattcattaatttatttttctgagtaaaaaaacgaaacccaaa       c.*1860

          .         .         .         .         .         .       g.50038
 tctcattttatttcaactgttaaacattttgatctgttgacccataggatcaggatttgg       c.*1920

          .         .         .         .         .         .       g.50098
 gaaccactttactaggaaagagcagatcagtaccatttgtataaaaccggcctcattatg       c.*1980

          .         .         .         .         .         .       g.50158
 taagaaagaaaatgttacgtgttttcttctttagcttggttgtgggcacttctacagcaa       c.*2040

          .         .         .         .         .         .       g.50218
 ggaccatatcatattcatctttgcatccctggcacagtgcatgagacataagtacttaat       c.*2100

          .         .         .         .         .         .       g.50278
 aaatgcagttgaatggataatgattagtgttatttatggattagaaaaagcatgtttcta       c.*2160

          .         .         .         .         .         .       g.50338
 tttaagtaagctgtaaaaagtattattgaatatttactgtaaatatatgttcacataaaa       c.*2220

          .         .         .         .         .         .       g.50398
 aaataacttggagggtctttgtgtccctggcatattatcatcttcatggaaagaatccac       c.*2280

          .         .         .         .         .         .       g.50458
 tgtggtttctgtagagtgattggaaaaatggattattttgaggattgaagaaagtgttct       c.*2340

          .         .         .         .         .         .       g.50518
 ttctgcgttgtcactttgttcaacagtaaaactttattctcagtgttcctactctgcatt       c.*2400

          .         .         .         .         .         .       g.50578
 gtttacatttttgacagttttttttaatcacctacaatctgtaaagaatgtatatattct       c.*2460

          .         .         .         .         .         .       g.50638
 tttcagcatctcagtttgaaaagacatgcagttaaacttgaccttttgataatcgctctt       c.*2520

          .         .         .         .         .         .       g.50698
 acaggtcattgtctgttctaacagcaaattgtaaacatgtgcttcatagatattgtggct       c.*2580

          .         .         .         .         .         .       g.50758
 ctcagtcatcactttgtcctatggtatttattgaatgttcacatactaatggtgcacagg       c.*2640

          .         .         .         .         .         .       g.50818
 tgtttttttctataaatcttctgactgtcctgtaattcattcttaagctttaacttgaag       c.*2700

          .         .         .         .         .         .       g.50878
 gtatcgtaattgccggcatttgatgtttagcaataaaagaataaatgtgtaccagcattt       c.*2760

                                                                    g.50886
 tatgttta                                                           c.*2768

 (downstream sequence)
Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The Membrane-bound transcription factor peptidase, site 2 protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.

Powered by LOVD v.3.0 Build 18
©2004-2017 Leiden University Medical Center