melanocortin 1 receptor (alpha melanocyte stimulating hormone receptor) (MC1R) - coding DNA reference sequence

(used for variant description)

(last modified November 25, 2020)

This file was created to facilitate the description of sequence variants on transcript NM_002386.3 in the MC1R gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_012026.1, covering MC1R transcript NM_002386.3.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
 .         .         .         .         .         .                g.5060
 agacgcagtcttcagcaaggaagtgctgggaacgccctggagtgaacccaggaagatgcc       c.-1321

 .         .         .         .         .         .                g.5120
 tgcagtgggtgccagggcccctctccaccgtccctgctgggcttcggggccacgcccgac       c.-1261

 .         .         .         .         .         .                g.5180
 tgctgtgaacggcctgcggagcaccacgtgcgacggctggaggcgagaggtctgcctttg       c.-1201

 .         .         .         .         .         .                g.5240
 atgtggctgttggtgcagggcctgtggtgccttccgcagcggaaatggcgcgccgcccgg       c.-1141

 .         .         .         .         .         .                g.5300
 ggagggcgggagcagcgtcccgggtgcccctgtgaggatgagcgacgagatgactggagg       c.-1081

 .         .         .         .         .         .                g.5360
 gtccctgaagacctcactagggtgcccccagccggtccgctcccaggaagcgacaccccc       c.-1021

 .         .         .         .         .         .                g.5420
 acagccccagggctgcagctgagggggtcgccactctggctgggcgaggctgggcccttg       c.-961

 .         .         .         .         .         .                g.5480
 ggggcaggcgccagagtggcctcaggctctacaagatgcctgaaaacaccaacctctcca       c.-901

 .         .         .         .         .         .                g.5540
 gggctcactagcattggacgctttcacgctctgccctggccggaagccccctcaccccgc       c.-841

 .         .         .         .         .         .                g.5600
 gcgatgtgcaaactcctgcagggctcactcagtttccagaactttaattattggaaagtt       c.-781

 .         .         .         .         .         .                g.5660
 ctccctggtccagcccccaaatctgccgtgaacgttgacagctgagttgctgctccatgc       c.-721

 .         .         .         .         .         .                g.5720
 gtgctttggctgagagcagaggggacccctgtcctccctgagctgctgacgaggggaggg       c.-661

 .         .         .         .         .         .                g.5780
 gtgaagggtggggcctctggagagggcaggtcccggggaagctccggactcctagagggg       c.-601

 .         .         .         .         .         .                g.5840
 cggccaggtgggggccctggtgaccaggacagactgtggtgttttttaacgtaaaggaga       c.-541

 .         .         .         .         .         .                g.5900
 tccgcggtgtgagggaccccctgggtcctgcacgccgcctggtggcaggccgggccatgg       c.-481

 .         .         .         .         .         .                g.5960
 tgggtgctcacgcccccggcatgtggccgccctcagtgggaggggctctgagaacgactt       c.-421

 .         .         .         .         .         .                g.6020
 tttaaaacgcagagaaaagctccattcttcccaggacctcagcgcagccctggcccagga       c.-361

 .         .         .         .         .         .                g.6080
 aggcaggagacagaggccaggacggtccagaggtgtcgaaatgtcctggggacctgagca       c.-301

 .         .         .         .         .         .                g.6140
 gcagccaccagggaagaggcagggagggagctgaggaccaggcttggttgtgagaatccc       c.-241

 .         .         .         .         .         .                g.6200
 tgagcccaggcggtagatgccaggaggtgtctggactggctgggccatgcctgggctgac       c.-181

 .         .         .         .         .         .                g.6260
 ctgtccagccagggagagggtgtgagggcagatctgggggtgcccagatggaaggaggca       c.-121

 .         .         .         .         .         .                g.6320
 ggcatgggggacacccaaggccccctggcagcaccatgaactaagcaggacacctggagg       c.-61

 .         .         .         .         .         .                g.6380
 ggaagaactgtggggacctggaggcctccaacgactccttcctgcttcctggacaggact       c.-1

          .         .         .         .         .         .       g.6440
 ATGGCTGTGCAGGGATCCCAGAGAAGACTTCTGGGCTCCCTCAACTCCACCCCCACAGCC       c.60
 M  A  V  Q  G  S  Q  R  R  L  L  G  S  L  N  S  T  P  T  A         p.20

          .         .         .         .         .         .       g.6500
 ATCCCCCAGCTGGGGCTGGCTGCCAACCAGACAGGAGCCCGGTGCCTGGAGGTGTCCATC       c.120
 I  P  Q  L  G  L  A  A  N  Q  T  G  A  R  C  L  E  V  S  I         p.40

          .         .         .         .         .         .       g.6560
 TCTGACGGGCTCTTCCTCAGCCTGGGGCTGGTGAGCTTGGTGGAGAACGCGCTGGTGGTG       c.180
 S  D  G  L  F  L  S  L  G  L  V  S  L  V  E  N  A  L  V  V         p.60

          .         .         .         .         .         .       g.6620
 GCCACCATCGCCAAGAACCGGAACCTGCACTCACCCATGTACTGCTTCATCTGCTGCCTG       c.240
 A  T  I  A  K  N  R  N  L  H  S  P  M  Y  C  F  I  C  C  L         p.80

          .         .         .         .         .         .       g.6680
 GCCTTGTCGGACCTGCTGGTGAGCGGGAGCAACGTGCTGGAGACGGCCGTCATCCTCCTG       c.300
 A  L  S  D  L  L  V  S  G  S  N  V  L  E  T  A  V  I  L  L         p.100

          .         .         .         .         .         .       g.6740
 CTGGAGGCCGGTGCACTGGTGGCCCGGGCTGCGGTGCTGCAGCAGCTGGACAATGTCATT       c.360
 L  E  A  G  A  L  V  A  R  A  A  V  L  Q  Q  L  D  N  V  I         p.120

          .         .         .         .         .         .       g.6800
 GACGTGATCACCTGCAGCTCCATGCTGTCCAGCCTCTGCTTCCTGGGCGCCATCGCCGTG       c.420
 D  V  I  T  C  S  S  M  L  S  S  L  C  F  L  G  A  I  A  V         p.140

          .         .         .         .         .         .       g.6860
 GACCGCTACATCTCCATCTTCTACGCACTGCGCTACCACAGCATCGTGACCCTGCCGCGG       c.480
 D  R  Y  I  S  I  F  Y  A  L  R  Y  H  S  I  V  T  L  P  R         p.160

          .         .         .         .         .         .       g.6920
 GCGCGGCGAGCCGTTGCGGCCATCTGGGTGGCCAGTGTCGTCTTCAGCACGCTCTTCATC       c.540
 A  R  R  A  V  A  A  I  W  V  A  S  V  V  F  S  T  L  F  I         p.180

          .         .         .         .         .         .       g.6980
 GCCTACTACGACCACGTGGCCGTCCTGCTGTGCCTCGTGGTCTTCTTCCTGGCTATGCTG       c.600
 A  Y  Y  D  H  V  A  V  L  L  C  L  V  V  F  F  L  A  M  L         p.200

          .         .         .         .         .         .       g.7040
 GTGCTCATGGCCGTGCTGTACGTCCACATGCTGGCCCGGGCCTGCCAGCACGCCCAGGGC       c.660
 V  L  M  A  V  L  Y  V  H  M  L  A  R  A  C  Q  H  A  Q  G         p.220

          .         .         .         .         .         .       g.7100
 ATCGCCCGGCTCCACAAGAGGCAGCGCCCGGTCCACCAGGGCTTTGGCCTTAAAGGCGCT       c.720
 I  A  R  L  H  K  R  Q  R  P  V  H  Q  G  F  G  L  K  G  A         p.240

          .         .         .         .         .         .       g.7160
 GTCACCCTCACCATCCTGCTGGGCATTTTCTTCCTCTGCTGGGGCCCCTTCTTCCTGCAT       c.780
 V  T  L  T  I  L  L  G  I  F  F  L  C  W  G  P  F  F  L  H         p.260

          .         .         .         .         .         .       g.7220
 CTCACACTCATCGTCCTCTGCCCCGAGCACCCCACGTGCGGCTGCATCTTCAAGAACTTC       c.840
 L  T  L  I  V  L  C  P  E  H  P  T  C  G  C  I  F  K  N  F         p.280

          .         .         .         .         .         .       g.7280
 AACCTCTTTCTCGCCCTCATCATCTGCAATGCCATCATCGACCCCCTCATCTACGCCTTC       c.900
 N  L  F  L  A  L  I  I  C  N  A  I  I  D  P  L  I  Y  A  F         p.300

          .         .         .         .         .                 g.7334
 CACAGCCAGGAGCTCCGCAGGACGCTCAAGGAGGTGCTGACATGCTCCTGGTGA             c.954
 H  S  Q  E  L  R  R  T  L  K  E  V  L  T  C  S  W  X               p.317

          .         .         .         .         .         .       g.7394
 gcgcggtgcacgcggctttaagtgtgctgggcagagggaggtggtgatattgtgtggtct       c.*60

          .         .         .         .         .         .       g.7454
 ggttcctgtgtgaccctgggcagttccttacctccctggtccccgtttgtcaaagaggat       c.*120

          .         .         .         .         .         .       g.7514
 ggactaaatgatctctgaaagtgttgaagcgcggacccttctgggtccagggaggggtcc       c.*180

          .         .         .         .         .         .       g.7574
 ctgcaaaactccaggcaggacttctcaccagcagtcgtggggaacggaggaggacatggg       c.*240

          .         .         .         .         .         .       g.7634
 gaggttgtggggcctcaggctccgggcaccaggggccaacctcaggctcctaaagagaca       c.*300

          .         .         .         .         .         .       g.7694
 ttttccgcccactcctgggacactccgtctgctccaatgactgagcagcatccaccccac       c.*360

          .         .         .         .         .         .       g.7754
 cccatctttgctgccagctctcaggaccgtgccctcgtcagctgggatgtgaagtctctg       c.*420

          .         .         .         .         .         .       g.7814
 ggtggaagtgtgtgccaagagctactcccacagcagccccaggagaaggggctttgtgac       c.*480

          .         .         .         .         .         .       g.7874
 cagaaagcttcatccacagccttgcagcggctcctgcaaaaggaggtgaaatccctgcct       c.*540

          .         .         .         .         .         .       g.7934
 caggccaagggaccaggtttgcaggagcccccctagtggtatggggctgagccctcctga       c.*600

          .         .         .         .         .         .       g.7994
 gggccggttctaaggctcagactgggcactggggcctcagcctgctttcctgcagcagtc       c.*660

          .         .         .         .         .         .       g.8054
 gcccaagcagacagccctggcaaatgcctgactcagtgaccagtgcctgtgagcatgggg       c.*720

          .         .         .         .                           g.8099
 ccaggaaagtctggtaataaatgtgactcagcatcacccacctta                      c.*765

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The Melanocortin 1 receptor (alpha melanocyte stimulating hormone receptor) protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.