microtubule associated monoxygenase, calponin and LIM domain containing 1 (MICAL1) - 273 nt intron 19 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.14912
gtaacccatcctcacagatgtgctgacccagggtgggacagggtgggagcactggcttcc  c.2581+60

         .         .         .         .         .         .  g.14972
tgcagaggaattctggggaatacagagggaagttgtggggatcccaggccgtggcagcct  c.2581+120

         .         g.14989
ctcctctgctccattct  c.2581+137

--------------------- middle of intron ---------------------
                                g.14990           .           g.15005
                                c.2582-136  tctcagttcctcccat  c.2582-121

.         .         .         .         .         .           g.15065
gccccaacacatacattcagtctttaccagacttgcagggcctccgtcaccaccatgctc  c.2582-61

.         .         .         .         .         .           g.15125
tttgttgcctgactggggcaggcgctggaggcagtagaacgtctcagttcttcttctcag  c.2582-1


Powered by LOVD v.3.0 Build 18
©2004-2017 Leiden University Medical Center