major intrinsic protein of lens fiber (MIP) - 438 nt intron 02 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.6121
gtaagcaggaaggagagcaacttctcattcaaggattccggggcccctaaacctttccca  c.525+60

         .         .         .         .         .         .  g.6181
acttttaagggttcttcctgcctacttcactgtcaaacatgaacattgtccattgcactc  c.525+120

         .         .         .         .         .         .  g.6241
tctactggcacaaaggaatcaactctgccctatccctctcttgtgactgctatatctagt  c.525+180

         .         .         .           g.6280
ccttcttgaccccaaggtagaaatgaacgtatcatggct  c.525+219

--------------------- middle of intron ---------------------
          g.6281              .         .         .           g.6319
          c.526-219  agacatgggctttgcctatggatccatagtctgttccca  c.526-181

.         .         .         .         .         .           g.6379
gacagggcatcagttgccctcaccccattgcaggaacccctggagagtcatgcaggctgt  c.526-121

.         .         .         .         .         .           g.6439
ccctctccacttgctgctggctggagaaaagatggcagctctcaggggcaatgtgggttg  c.526-61

.         .         .         .         .         .           g.6499
tggggagagaagctggggtgcagtaggggggtgtctcagttacaactgtctcttttgcag  c.526-1


Powered by LOVD v.3.0 Build 18
©2004-2017 Leiden University Medical Center