megalencephalic leukoencephalopathy with subcortical cysts 1 (MLC1) - 488 nt intron 06 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.13589
gtgggtgcagcttctgaccccgcagggcagggggtgcagaggcatcaccccagggtgagc  c.525+60

         .         .         .         .         .         .  g.13649
gaggtgggtctcagcgtcaccctcggagggccgatctgggctgctccagggcattcccat  c.525+120

         .         .         .         .         .         .  g.13709
gagacccctctctcctgggtctcagaaaccccggccaggaggggctctggagctgggtga  c.525+180

         .         .         .         .         .         .  g.13769
ggggttggcggccgctggctacagggaggtgaagacagatgctgtaccctcccctccccc  c.525+240

      g.13773
taag  c.525+244

--------------------- middle of intron ---------------------
                                             g.13774          g.13777
                                             c.526-244  cctg  c.526-241

.         .         .         .         .         .           g.13837
actcagtccagtgctcgtccccaggggatcaccaggagacaccacatctgctaattttca  c.526-181

.         .         .         .         .         .           g.13897
tatgcaaggacaatgtgtgtgaacatttcctcaagcccaaagatccacgggcgcctccaa  c.526-121

.         .         .         .         .         .           g.13957
ggcggtctcgcatctacacggcaggctgacctgacccactgcccacggcggccggatgcc  c.526-61

.         .         .         .         .         .           g.14017
agcggcagtgctgagtccctgtgcccgtgcacccggggtgacagttctgtttcttcgtag  c.526-1


Powered by LOVD v.3.0 Build 20c
©2004-2018 Leiden University Medical Center