methylmalonic aciduria (cobalamin deficiency) cblB type (MMAB) - coding DNA reference sequence

(used for variant description)

(last modified September 25, 2018)

This file was created to facilitate the description of sequence variants on transcript NM_052845.3 in the MMAB gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_007096.1, covering MMAB transcript NM_052845.3.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
                                                   .                g.4957
                                                agctgtgggtgga       c.-61

 .         .         .         .         .         .                g.5017
 gtcaccccgcggactggacgggaacctggcggggtcaggtcccgtcaagcagcctggctc       c.-1

          .         .         .         .         .         .       g.5077
 ATGGCTGTGTGCGGCCTGGGGAGCCGTCTTGGCCTGGGGAGCCGTCTTGGCCTGCGCGGG       c.60
 M  A  V  C  G  L  G  S  R  L  G  L  G  S  R  L  G  L  R  G         p.20

          .         .         .         .         .         .       g.5137
 TGCTTCGGCGCCGCCAGGCTCCTGTATCCCCGTTTCCAGAGCCGCGGCCCTCAGGGCGTG       c.120
 C  F  G  A  A  R  L  L  Y  P  R  F  Q  S  R  G  P  Q  G  V         p.40

          .     | 02   .         .         .         .         .    g.6833
 GAAGACGGGGACAG | GCCACAGCCTTCCTCGAAGACACCCAGGATCCCCAAGATTTACACC    c.180
 E  D  G  D  R  |  P  Q  P  S  S  K  T  P  R  I  P  K  I  Y  T      p.60

          .       | 03 .         .         .         .         .    g.9678
 AAAACGGGAGACAAAG | GGTTTTCTAGTACCTTCACAGGAGAAAGGAGACCCAAAGATGAC    c.240
 K  T  G  D  K  G |   F  S  S  T  F  T  G  E  R  R  P  K  D  D      p.80

          .         .         .         .         . | 04       .    g.13331
 CAAGTGTTTGAAGCCGTGGGAACTACAGATGAATTAAGTTCAGCTATTGG | GTTTGCTCTG    c.300
 Q  V  F  E  A  V  G  T  T  D  E  L  S  S  A  I  G  |  F  A  L      p.100

          .         .         .         .         | 05         .    g.16657
 GAATTAGTCACAGAAAAGGGCCATACATTTGCCGAAGAGCTTCAGAAA | ATCCAGTGCACA    c.360
 E  L  V  T  E  K  G  H  T  F  A  E  E  L  Q  K   | I  Q  C  T      p.120

          .         .         .         .         .         .       g.16717
 TTGCAGGACGTCGGCTCGGCCCTGGCGACACCATGCTCCTCGGCCCGGGAGGCTCACTTA       c.420
 L  Q  D  V  G  S  A  L  A  T  P  C  S  S  A  R  E  A  H  L         p.140

   | 06      .         .         .         .         .         .    g.17039
 A | AGTATACCACGTTCAAGGCGGGGCCCATCCTGGAGCTGGAGCAGTGGATCGACAAGTAC    c.480
 K |   Y  T  T  F  K  A  G  P  I  L  E  L  E  Q  W  I  D  K  Y      p.160

          .         .         .          | 07        .         .    g.17414
 ACCAGCCAGCTCCCACCACTCACGGCCTTCATCCTGCCT | TCGGGAGGCAAGATCAGCTCG    c.540
 T  S  Q  L  P  P  L  T  A  F  I  L  P   | S  G  G  K  I  S  S      p.180

          .         .         .         .     | 08   .         .    g.19358
 GCGCTGCATTTCTGCCGGGCCGTGTGCCGCCGGGCCGAGAGACG | TGTGGTGCCTCTTGTC    c.600
 A  L  H  F  C  R  A  V  C  R  R  A  E  R  R  |  V  V  P  L  V      p.200

          .         .         .         .     | 09   .         .    g.21377
 CAGATGGGAGAGACCGATGCGAACGTGGCCAAGTTCTTAAACAG | ACTCAGTGACTATCTC    c.660
 Q  M  G  E  T  D  A  N  V  A  K  F  L  N  R  |  L  S  D  Y  L      p.220

          .         .         .         .         .         .       g.21437
 TTCACGCTAGCCAGATATGCAGCCATGAAGGAGGGGAATCAAGAGAAAATATACATGAAA       c.720
 F  T  L  A  R  Y  A  A  M  K  E  G  N  Q  E  K  I  Y  M  K         p.240

          .         .         .                                     g.21470
 AATGACCCATCGGCCGAGTCTGAGGGACTCTGA                                  c.753
 N  D  P  S  A  E  S  E  G  L  X                                    p.250

          .         .         .         .         .         .       g.21530
 aatcacagaaagtgggagcttggaggatccctccatggcgatggccgtggagagaggagc       c.*60

          .         .         .         .         .         .       g.21590
 ttgcccttctggggtcctggttcctgaagagctcacccagagaggctcaaagcagccttt       c.*120

          .         .         .         .         .         .       g.21650
 tgtcccagctcagctttgatctacacctcttgccaccttcctcaagggactgtgaccctt       c.*180

          .         .         .         .         .         .       g.21710
 tggggattctgtccctgaccctgcttccccaagctctcctgggtcttggagggatgtggg       c.*240

          .         .         .         .         .         .       g.21770
 aatgaattggcattgcaggaaagacaggtaaagtgattgctgcaatgagaaggagctgtg       c.*300

          .         .         .         .         .         .       g.21830
 cggaaaaggaataaaagttggaaaggctggagccgtgtgtgtgtgtgtgtgtgtgtgtgt       c.*360

          .         .         .         .         .         .       g.21890
 gtgtgtgtgtgtgtgtgtgagagagagccctcccactgccagctcaggttgttcacagat       c.*420

          .         .         .         .         .         .       g.21950
 ttggaatgggaccagaggcccttgaaaatgtaattgtgatttacctgtgccaaaggtgct       c.*480

          .         .         .         .         .         .       g.22010
 ttaaatgtcacatttgtaaaggggaaggcggacaagatttggaagtttagtcacctctga       c.*540

          .         .         .         .         .         .       g.22070
 gccacccatcaccgccaaagtgtgggggaaggatagctgcagattgacaggcgaggctca       c.*600

          .         .         .         .         .         .       g.22130
 gaaactcctggcttagattgaagtgtgtgtgatgggggtgcagcttagaggaccccctct       c.*660

          .         .         .         .         .         .       g.22190
 gaaagggatggagatgctgatgagaacaacactaccacttgaaggtgaacattccctgtc       c.*720

          .         .         .         .         .         .       g.22250
 tggttggactgagtcaagggtctgcggtgcagcatcttcagcttgagaaaatgaggttgt       c.*780

          .         .         .         .         .         .       g.22310
 cagtttccagcaaggctgacatccaccagactgatttctccgatgttgcacttggctggc       c.*840

          .         .         .         .         .         .       g.22370
 ttatgcctctgagatcggtgccacggctgtatttatttcagttgtcactgctgctccctc       c.*900

          .         .         .         .         .         .       g.22430
 ctgctatgaaacgacactgccagtgccagcagtgtccttgggaaaggcaatatttatgaa       c.*960

          .         .         .         .         .         .       g.22490
 gggcagaagaggcagccccaagaacctaaagactgcaggctgctaattgcaggaaatgac       c.*1020

          .         .         .         .         .         .       g.22550
 tttggaagggcaggctcttgtccagtttcagggctgaaatgcctggcgaactccattcag       c.*1080

          .         .         .         .         .         .       g.22610
 ccatcacatattgactgagtggctgcttagcatgggccaccgcgctaggctcgggacagc       c.*1140

          .         .         .         .         .         .       g.22670
 tggtctttccggccatctttcttgctggcaagtcagcaaacattaccttcttagtcacgt       c.*1200

          .         .         .         .         .         .       g.22730
 gcatatttttgccttcattcttaccacctggcctgcaaagtttgcaggagggccaggtat       c.*1260

          .         .         .         .         .         .       g.22790
 attcacttgtgtcttctgggtcctttcattgctgacaggctgtgatggccctcttgagcc       c.*1320

          .         .         .         .         .         .       g.22850
 ttgggcagggtgggtgaggtgcagatgaccaggagtgtgtgaatgccttccaggaggtgg       c.*1380

          .         .         .         .         .         .       g.22910
 ctttgttccgtgcctccctgcccccatcgtcactaccaggtctggtacggagtcggtgct       c.*1440

          .         .         .         .         .         .       g.22970
 cagtgtttgcaaaacagagctgaaaacggactttgggaggccgaggcaggcagatcacct       c.*1500

          .         .         .         .         .         .       g.23030
 gaggtcaggagtttgagaccagcctggtcaacatggtaaaaccccatttctgctaaaaaa       c.*1560

          .         .         .         .         .         .       g.23090
 aaaaaaaaaaaaaaaaaattagctgggcatggtggcgggtgcctgtaatcccagctattc       c.*1620

          .         .         .         .         .         .       g.23150
 aggaggctgaggcaggagaatcacttgaacctacgaggcagaggctgcagtgagccaaga       c.*1680

          .         .         .         .         .         .       g.23210
 tcgtgacacgacactccagcctggctgatagagtgagactccgtcacaaaaaaaaaaaaa       c.*1740

          .         .         .         .         .         .       g.23270
 aaaaaaaaaaaaccctgaaaacgcaatcactaaggctcggtcagggagtatgttcaaaga       c.*1800

          .         .         .         .         .         .       g.23330
 gcttgcagcgaatcactcaattctgtctacacctcaaaatctcaaaatcttcctggaata       c.*1860

          .         .         .         .         .         .       g.23390
 tatatatatatataaaataacacagcagccctgcatgcctagccatgggaaagcacagcc       c.*1920

          .         .         .         .         .         .       g.23450
 tccaaaggataaggaaagctttttgagtaaatacaacatcctaaagtgacaatctttgaa       c.*1980

          .         .         .         .         .         .       g.23510
 acaaggccgttcacctgttgccaagtcctgtccttccaggaccgggtgtcacagcctgga       c.*2040

          .         .         .         .         .         .       g.23570
 tgttaacagtcgcgttctcagacccccgcctctgtatctgtctcccggttcaccagcaaa       c.*2100

          .         .         .         .         .         .       g.23630
 cacttctctgagaaaccacctgggtgcagggcagatgccaccactcagcaggtgtttctc       c.*2160

          .         .         .         .         .         .       g.23690
 tcctgtgctaccaacctgggaaaaatggagaaagcttgctttgggggctggaaggatggg       c.*2220

          .         .         .         .         .         .       g.23750
 gtgtttaaaacatttgctcttctgcagtgcctttcaaaagctctatcaagagcccgaggc       c.*2280

          .         .         .         .         .         .       g.23810
 aaaagaaaagatgtgtacccctctgtacactgagcaaatgtcctcccatattttgaacca       c.*2340

          .         .         .         .         .         .       g.23870
 ggtgggaaaagttaatgaaagccctacagtcaggaaatgtgactgcgaagcccccgctgc       c.*2400

          .         .         .         .         .         .       g.23930
 cccagtgtttgcacaccactggcaactctcagaaacaatcagtcccattgcacgggaaca       c.*2460

          .         .         .         .         .         .       g.23990
 cggggttttgaaacaaacagcagcctgtttttatttaaagtcgtgatcccttgcttatcg       c.*2520

          .         .         .         .         .         .       g.24050
 tagatttttttcataatttgattttggaaaatattgcacacaaatactactcgatccctg       c.*2580

          .         .         .         .         .         .       g.24110
 agtttgtgggcacttccttacattttgcacccatgaaaatgcctcctccgcctccaggtc       c.*2640

          .         .         .         .         .         .       g.24170
 aggctccctggaatggggtgtttagtgtcatttccagagacaagctggcagttggctctt       c.*2700

          .         .         .         .         .         .       g.24230
 gtgtcagagagaagcccacagtcacagtgacaccagcccgcactgtggaagggcttgcta       c.*2760

          .         .         .         .         .         .       g.24290
 tgtgcagtgccctgagccaagtgttccacagacattatctcatttgaaccccatagcagc       c.*2820

          .         .         .         .         .         .       g.24350
 cctggaaggaggcattgggtggggaaccaagttgtcctggggagtcagtgccaagatgtg       c.*2880

          .         .         .         .         .         .       g.24410
 agccccggacgcggcctcgtcactcacagccccgtgctcctcagctcccacccactgccg       c.*2940

          .         .         .         .         .         .       g.24470
 cttgacagtcgttttaatcactacctgggctgtggcgaacaatgccaggctctgatagat       c.*3000

          .         .         .         .         .         .       g.24530
 cctgctgtctcatttctcaacctagtttcccttaactaatatttcatggctatcgttaat       c.*3060

          .         .         .         .         .         .       g.24590
 gtgcgtttttcatcgagtaatttccacagcccgaacttgtaacacatcccaatgacaaac       c.*3120

          .         .         .         .         .         .       g.24650
 gtccccagttcggaagcccccgtcagtggcaatgtcacccttgctgctgcctcgacacct       c.*3180

          .         .         .         .         .         .       g.24710
 tccgacagcccattcagttttatgatcgccctgtcccagtgatcactactgaacctttaa       c.*3240

          .         .         .         .         .         .       g.24770
 gaatccagatgcatttcaagtttaattgaataaaattctttgtataataaattccgcatg       c.*3300

          .                                                         g.24783
 aatgctacataaa                                                      c.*3313

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The Methylmalonic aciduria (cobalamin deficiency) cblB type protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.