M-phase specific PLK1 interacting protein (MPLKIP) - coding DNA reference sequence

(used for variant description)

(last modified September 10, 2015)

This file was created to facilitate the description of sequence variants on transcript NM_138701.3 in the MPLKIP gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_016989.2, covering MPLKIP transcript NM_138701.3.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
                                         .         .                g.5025
                                    ggactagcagttctctgcggagggc       c.-61

 .         .         .         .         .         .                g.5085
 cggttgatacagttccggtgggagaacgcggctgcgaggttttcggctttggctcctgat       c.-1

          .         .         .         .         .         .       g.5145
 ATGCAGCGACAGAATTTTCGGCCCCCAACTCCTCCTTACCCTGGTCCGGGTGGAGGAGGT       c.60
 M  Q  R  Q  N  F  R  P  P  T  P  P  Y  P  G  P  G  G  G  G         p.20

          .         .         .         .         .         .       g.5205
 TGGGGTAGCGGAAGCAGCTTCCGGGGAACCCCGGGCGGGGGCGGACCACGGCCGCCCTCC       c.120
 W  G  S  G  S  S  F  R  G  T  P  G  G  G  G  P  R  P  P  S         p.40

          .         .         .         .         .         .       g.5265
 CCTCGAGACGGGTACGGGAGTCCGCACCACACGCCGCCGTACGGGCCCCGGTCTAGGCCG       c.180
 P  R  D  G  Y  G  S  P  H  H  T  P  P  Y  G  P  R  S  R  P         p.60

          .         .         .         .         .         .       g.5325
 TACGGGAGCAGTCACTCTCCGCGACACGGCGGCAGCTTCCCGGGGGGCCGGTTCGGGTCT       c.240
 Y  G  S  S  H  S  P  R  H  G  G  S  F  P  G  G  R  F  G  S         p.80

          .         .         .         .         .         .       g.5385
 CCGTCCCCTGGCGGCTACCCTGGCTCCTACTCCAGGTCCCCCGCGGGGTCCCAGCAGCAA       c.300
 P  S  P  G  G  Y  P  G  S  Y  S  R  S  P  A  G  S  Q  Q  Q         p.100

          .         .         .          | 02        .         .    g.6414
 TTCGGCTACTCCCCAGGGCAGCAGCAGACCCACCCCCAG | GGTTCTCCAAGGACATCTACA    c.360
 F  G  Y  S  P  G  Q  Q  Q  T  H  P  Q   | G  S  P  R  T  S  T      p.120

          .         .         .         .         .         .       g.6474
 CCATTTGGATCAGGGCGTGTTAGAGAAAAAAGAATGTCTAATGAGTTGGAAAATTATTTC       c.420
 P  F  G  S  G  R  V  R  E  K  R  M  S  N  E  L  E  N  Y  F         p.140

          .         .         .         .         .         .       g.6534
 AAGCCTTCAATGCTTGAAGATCCTTGGGCTGGCCTAGAACCAGTATCTGTAGTGGATATA       c.480
 K  P  S  M  L  E  D  P  W  A  G  L  E  P  V  S  V  V  D  I         p.160

          .         .         .         .         .         .       g.6594
 AGCCAACAATACAGCAATACTCAAACATTCACAGGCAAAAAAGGAAGATACTTTTGTTAA       c.540
 S  Q  Q  Y  S  N  T  Q  T  F  T  G  K  K  G  R  Y  F  C  X         p.179

          .         .         .         .         .         .       g.6654
 catttctgaaattcaactggaagcttcatgtgtcaggaacatcttggacaaaactttaag       c.*60

          .         .         .         .         .         .       g.6714
 ttgtgttgatataaatttacccaaagatgatgactttgattggataattagtaaggtctt       c.*120

          .         .         .         .         .         .       g.6774
 tttgttatttttcatcgtatcaggtattgttgatattagagaaaaaagtaggataacttg       c.*180

          .         .         .         .         .         .       g.6834
 caacatttagctctggaagtacctaccacattttagagatttaccgtttccatatattta       c.*240

          .         .         .         .         .         .       g.6894
 acattcctggttacataatggacatttgtcttttaatgttttttcaatgttttaaaataa       c.*300

          .                                                         g.6910
 aacattttgtcttcta                                                   c.*316

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The M-phase specific PLK1 interacting protein protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.