MpV17 mitochondrial inner membrane protein (MPV17) - coding DNA reference sequence

(used for variant description)

(last modified February 2, 2014)


This file was created to facilitate the description of sequence variants on transcript NM_002437.4 in the MPV17 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NC_000002.11, covering MPV17 transcript NM_002437.4.


Please note that introns are available by clicking on the exon numbers above the sequence.
 (upstream sequence)
           .         .         .         .         .     | 02       g.5585
     gcggaagttcctaggccagcctgtcacgtgggagggaggctcggcgctcag | gaagc    c.-1

          .         .         .         .         .         .       g.5645
 ATGGCACTCTGGCGGGCATACCAGCGGGCCCTGGCCGCTCACCCGTGGAAAGTACAGGTC       c.60
 M  A  L  W  R  A  Y  Q  R  A  L  A  A  H  P  W  K  V  Q  V         p.20

          . | 03       .         .         .         .         .    g.15043
 CTGACAGCTG | GGTCCCTGATGGGCCTGGGTGACATTATCTCACAGCAGCTGGTGGAGAGG    c.120
 L  T  A  G |   S  L  M  G  L  G  D  I  I  S  Q  Q  L  V  E  R      p.40

          .         .         .         .         .         .       g.15103
 CGGGGTCTGCAGGAACACCAGAGAGGCCGGACTCTGACCATGGTGTCCCTGGGCTGTGGC       c.180
 R  G  L  Q  E  H  Q  R  G  R  T  L  T  M  V  S  L  G  C  G         p.60

        | 04 .         .         .         .         .         .    g.15384
 TTTGTG | GGCCCTGTGGTAGGAGGCTGGTACAAGGTTTTGGATCGGTTCATCCCTGGCACC    c.240
 F  V   | G  P  V  V  G  G  W  Y  K  V  L  D  R  F  I  P  G  T      p.80

          .         .         .          | 05        .         .    g.15534
 ACCAAAGTGGATGCACTGAAGAAGATGTTGTTGGATCAG | GGGGGCTTTGCCCCGTGTTTT    c.300
 T  K  V  D  A  L  K  K  M  L  L  D  Q   | G  G  F  A  P  C  F      p.100

          .         .         .         .         .         .       g.15594
 CTAGGCTGCTTTCTCCCACTGGTAGGGGCACTTAATGGACTGTCAGCCCAGGACAACTGG       c.360
 L  G  C  F  L  P  L  V  G  A  L  N  G  L  S  A  Q  D  N  W         p.120

          .      | 06  .         .         .         | 07         . g.16162
 GCCAAACTACAGCGG | GATTATCCTGATGCCCTTATCACCAACTACTAT | CTATGGCCTGCT c.420
 A  K  L  Q  R   | D  Y  P  D  A  L  I  T  N  Y  Y   | L  W  P  A   p.140

          .         .         .         .  | 08      .         .    g.18139
 GTGCAGTTAGCCAACTTCTACCTGGTCCCCCTTCATTACAG | GTTGGCCGTTGTCCAATGT    c.480
 V  Q  L  A  N  F  Y  L  V  P  L  H  Y  R  |  L  A  V  V  Q  C      p.160

          .         .         .         .         .                 g.18190
 GTTGCTGTTATCTGGAACTCCTACCTGTCCTGGAAGGCACATCGGCTCTAA                c.531
 V  A  V  I  W  N  S  Y  L  S  W  K  A  H  R  L  X                  p.176

          .         .         .         .         .         .       g.18250
 gcctgcctcactccatcgtttccaccttgcagtgatgcagcttgaccctggaacggtcag       c.*60

          .         .         .         .         .         .       g.18310
 acaacctcctcaaagtgggcataccagtttccacggggttgggttgccggtcagagctta       c.*120

          .         .         .         .         .         .       g.18370
 agaggactagcaccctgcaatgcccctcttcactctaaaatgtacactgactgctttaga       c.*180

          .         .         .         .         .         .       g.18430
 gcccttgataatagtcttattcccaccacatactaggcactccataaatatctgttgaac       c.*240

          .         .         .         .         .         .       g.18490
 cttcatgaccttatcaactttacacccatatcccagcaaatgccactcatccccactctt       c.*300

          .         .         .         .         .         .       g.18550
 catagacacatttgttactctaaccctgcctaggcttcttgtagctccagctctttagag       c.*360

          .         .         .         .         .         .       g.18610
 actcccggaaccctttatatggtgcctcagtaaatatgttattaaatatgtaatccggaa       c.*420

 

 (downstream sequence)
Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The MpV17 mitochondrial inner membrane protein protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.

Powered by LOVD v.3.0 Build 09
©2004-2014 Leiden University Medical Center