mitochondrial ribosomal protein S16 (MRPS16) - coding DNA reference sequence

(used for variant description)

(last modified June 6, 2018)

This file was created to facilitate the description of sequence variants on transcript NM_016065.3 in the MRPS16 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_008096.1, covering MRPS16 transcript NM_016065.3.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
                               .         .         .                g.5031
                              attgtgggaagtatagggcggcaagcggagg       c.-181

 .         .         .         .         .         .                g.5091
 aggcgtggcgagcggatcatccgcttccggagtcgaggttttcgggcttgtaccgcttgg       c.-121

 .         .         .         .         .         .                g.5151
 cggtgcggcctggtgtcggcttgcaggttctttctgtgtttgttctctgccctgccaagg       c.-61

 .         .         .         .         .         .                g.5211
 ccgtagagctggtgcgtgcgggtagcggggctctccgaggagccgcacgccggcggcacc       c.-1

          .    | 02    .         .         .         .         .    g.5717
 ATGGTCCACCTCA | CTACTCTCCTCTGCAAGGCCTACCGTGGGGGCCACTTAACCATCCGC    c.60
 M  V  H  L  T |   T  L  L  C  K  A  Y  R  G  G  H  L  T  I  R      p.20

          .         .         .         .         .         .       g.5777
 CTTGCCCTGGGTGGCTGCACCAATCGGCCGTTCTACCGCATTGTGGCTGCTCACAACAAG       c.120
 L  A  L  G  G  C  T  N  R  P  F  Y  R  I  V  A  A  H  N  K         p.40

          .         .         .         .         .         .       g.5837
 TGTCCCAGGGATGGCCGTTTCGTAGAGCAGCTGGGCTCCTATGATCCATTGCCCAACAGT       c.180
 C  P  R  D  G  R  F  V  E  Q  L  G  S  Y  D  P  L  P  N  S         p.60

          .         .         .         .         .         .       g.5897
 CATGGAGAAAAACTCGTTGCCCTCAACCTAGACAGGATCCGTCATTGGATTGGCTGCGGG       c.240
 H  G  E  K  L  V  A  L  N  L  D  R  I  R  H  W  I  G  C  G         p.80

          .         .         .     | 03   .         .         .    g.6728
 GCCCACCTCTCTAAGCCTATGGAAAAGCTTCTGG | GTCTTGCTGGCTTTTTCCCTCTGCAT    c.300
 A  H  L  S  K  P  M  E  K  L  L  G |   L  A  G  F  F  P  L  H      p.100

          .         .         .         .         .         .       g.6788
 CCTATGATGATCACAAATGCTGAGAGACTGCGAAGGAAACGGGCACGTGAAGTCCTGTTA       c.360
 P  M  M  I  T  N  A  E  R  L  R  R  K  R  A  R  E  V  L  L         p.120

          .         .         .         .         .                 g.6842
 GCTTCTCAGAAAACAGATGCAGAAGCTACAGATACAGAGGCTACAGAAACATAA             c.414
 A  S  Q  K  T  D  A  E  A  T  D  T  E  A  T  E  T  X               p.137

          .         .         .         .         .         .       g.6902
 atgagctgactttagtgagcatagcagtgggaacaaggtcaaggtccttttgaaacactg       c.*60

          .         .         .         .         .         .       g.6962
 cagcgatcttaattttgttagatttggagttcaataaatggagtatcctgagttgccctt       c.*120

          .         .         .         .         .         .       g.7022
 gctcttctggcctggcctgcacagggcccagggagagatttgttcttgtgtgacttagag       c.*180

          .         .         .         .         .         .       g.7082
 ctgggtgtgggtactaattagcttttttcgactttgtcttgggatagacagtggctatgg       c.*240

          .         .         .         .         .         .       g.7142
 gaggattggacttttgagttgggctctgggtctcttggacaactttacaatttactggct       c.*300

          .         .         .         .         .         .       g.7202
 tccaagacttcctgcttcaaaacccccagccagactattcatggcccattcagatcttca       c.*360

          .         .         .         .         .         .       g.7262
 tgttcatcccacaagtgcaagaacagttaacctttcttaattgatttttgtaattggagg       c.*420

          .         .         .         .         .         .       g.7322
 tttatattgtcttgcctaatgcatattctctttttttttttttttttgagacggagtctt       c.*480

          .         .         .         .         .         .       g.7382
 gttctgttgccaggctggagtgcggtggtgcaatctcagctcactgcaatctccacctcc       c.*540

          .         .         .         .         .         .       g.7442
 tgggttcaagaggttctcctgcctcagcctcctgagtagccggggagctacaagcatgca       c.*600

          .         .         .         .         .         .       g.7502
 ccaccacacccagctaattttttttttttttttgagaggagtctcgctctgtcgcccagg       c.*660

          .         .         .         .         .         .       g.7562
 cttgagtgcagtggcgcgatctcggctcactgcaagctctgtctcctgggttcatgccat       c.*720

          .         .         .         .         .         .       g.7622
 tctcctgcttcagcctcccgagtagtcccaggagtagctgggactacaggtgcccaccac       c.*780

          .         .         .         .         .         .       g.7682
 cacacccagctaatttttttgtatttttagtagagatggggtttcaccatgttatccagg       c.*840

          .         .         .         .         .         .       g.7742
 atggttttgatctcctgacctcgtgatccgcccgccttggcctcccaaaagtgctgggat       c.*900

          .         .         .         .         .         .       g.7802
 tataggcgtgagccaccgcccgggcaaatttttgtatttttagtagagatggggtttcac       c.*960

          .         .         .         .         .         .       g.7862
 cgtgttggccaggatggtctcaatctgaccttgtgatctgcccacctcggcctcccaaag       c.*1020

          .         .         .         .         .         .       g.7922
 tgctaggattactggcgtgagccaccactcctagccttaatgcatattcttaaatataca       c.*1080

          .         .         .         .         .         .       g.7982
 aaggtagatttgttatgaaaattgctttggggctctaataacctaccttttaagaatgag       c.*1140

          .         .         .         .         .         .       g.8042
 aaactgctgggcttaagggagttcagtatgaatcaagattgaaccattcaaatgtggctg       c.*1200

          .         .         .         .         .         .       g.8102
 tgatttctgcatatatcatagatgggatccttctgagaatactggaatagggaattagga       c.*1260

          .         .         .         .         .         .       g.8162
 caccaagccaattcagctgtgaaccttattcttgtacttttctttcttgctggtaatttt       c.*1320

          .         .         .         .         .         .       g.8222
 atggagcaggttaagaaggctgctctgtgttaggataaactgtataccaataatgttgac       c.*1380

          .         .         .         .         .         .       g.8282
 aacctgtaatgagtgttgcattttacttcttgtatcttttccttcctaccttgatgccag       c.*1440

          .         .         .         .         .         .       g.8342
 taatctataagggatctttatagtttgaatgtatttgaataacttcagtatactttagtt       c.*1500

          .         .         .         .         .         .       g.8402
 ctacttttttatttgactcacaaccattcttaggtctcaagtattcccatgtgttttaaa       c.*1560

          .         .         .         .         .         .       g.8462
 agcctgaagtcagtgagatgaaattcaacatcaagaatttgaagtaacttgtaaggaaaa       c.*1620

          .         .         .         .         .         .       g.8522
 ataatataaagataccattggggcagtggctcacacctgtaatctcagcactttgggagg       c.*1680

          .         .         .         .         .         .       g.8582
 ctgaggtggaaggatcacttgaagccagagtttgagaccagcctgtgcaacacagcaaga       c.*1740

          .         .         .         .         .         .       g.8642
 ccccgtctctacaaaaacttaaaaaattagctggctgtggtgttgctcacccatagttcc       c.*1800

          .         .         .         .         .         .       g.8702
 agctactcgggaagctgaggcagtaagatcacttgagcccaggaggccgatgctgcagtg       c.*1860

          .         .         .         .         .         .       g.8762
 aactgtgattgttccactacagtccagcctgggtgacagagaaaagaaaaagaaaacatt       c.*1920

          .         .         .         .         .         .       g.8822
 acataatttggctagagcataataatttgattttctggtttttgaaaatttgagttgcaa       c.*1980

          .         .                                               g.8851
 taaaaggatatttcagtgtgcgatttcaa                                      c.*2009

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The Mitochondrial ribosomal protein S16 protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.