mutS homolog 6 (E. coli) (MSH6) - downstream reference sequence


         .         .         .            .         .         . g.28834
tatgatctaataaactttattttttaaaaatga / ccatttttccattttctttctaggaaa c.*120

         .         .         .         .         .         .    g.28894
ttaaacccttttaattcttatctaccttctacataatggttattgaatactccacaatat    c.*180

         .         .         .         .         .         .    g.28954
attaagtctagatgttatggtacatgcatacactttcaggctgttttatacccactgtca    c.*240

         .         .         .         .         .         .    g.29014
ccaatacacataaatgggggaggaaaagctatgaaactgtatagggctgtatatatactt    c.*300

         .         .         .         .         .         .    g.29074
gtctcagcttaatgcaggaaattggtttaatttccagcagttttgtctaaactgttcaaa    c.*360

         .         .         .         .         .         .    g.29134
aaaaaactatgaacagagttcaaatacaggactgtttgttttgaagagactttctaaagt    c.*420

         .         .         .         .         .         .    g.29194
gtacttaaaacatagtagttttttacctttcacaaaactgagttacaagaatacttttgt    c.*480

         .         .         .         .         .         .    g.29254
tttacagtgcatcccttcctaggaagtctcattaaaacactcactttttctaggggtgat    c.*540

         .         .         .         .         .         .    g.29314
tttgaatgctgcacagggaagggaaggaaataatagtcttaacttttcttaaaggatacc    c.*600

         .         .         .         .         .         .    g.29374
agaaacattgctggatataatttaagattagtgttttctctttcatagaaagaacgtaca    c.*660

         .         .         .         .         .         .    g.29434
tactgggacatgagtacagttacagcaagtctaggtgtgctaacaaaacagggcacattc    c.*720

         .         .         .         .         .         .    g.29494
aagtacagtaagattttgcttgaaattaaaaacaaactacatgagattaaagcattaaaa    c.*780

         .         .         .         .         .         .    g.29554
tcatatttctcaatctgaatacatgttaaaaaaaaaaaatcaaaaggaacgcagaagtgc    c.*840

         .         .         .         .         .         .    g.29614
tagctcacatttttaccatattacaaaagcaattggtacccatgtccataaaggcagcaa    c.*900

         .         .         .         .         .         .    g.29674
caaagctgcttgtctattgaagattactactgcaaattggactgcattcaatgctagttg    c.*960

         .         .         .         .         .         .    g.29734
taaaaacaccagcttttcagaagttggtatctgtacaaaattgcagcttattttcttcac    c.*1020

         .         .         .         .         .         .    g.29794
ttctgtcccttcaagtctttacacagtaatgctaaaacacccagctttgagatcctgagt    c.*1080

         .         .         .         .         .         .    g.29854
caatatattgccactttctttttggtagcttgagcttcatagtgtcaactgaccttgtgt    c.*1140

         .         .         .         .         .         .    g.29914
atccatttttaatacagtctcttcctgtagcatgggcaaatattttaaatcttcttccaa    c.*1200

         .         .         .         .         .         .    g.29974
aaaagtgttttaagttatgatgttacaatggcaggactttttctttagggaaggaattca    c.*1260

         .         .         .         .         .         .    g.30034
gttgtgctgcaatgtattagattctataggtggagcagagtcatatagtgtatctgtatc    c.*1320

         .         .         .         .         .         .    g.30094
atgtgtaggctcaccagctaatgtacaaggattagacagtgttccagcaccacagtcaca    c.*1380

         .         .         .         .         .         .    g.30154
gaaaaacctaaagcaaaatgaaacccaaatattagaaaagtgagggggaaagtaattggg    c.*1440

         .         .         .         .         .         .    g.30214
taatatatcaagcaagtgtgctacatacctatcatgtctaataaactctacatcatgtcc    c.*1500

         .         .         .         .         .         .    g.30274
ctgatggcacttcttaatgcagttcacacatatggcatttcgatctgtggtgttacaagt    c.*1560

         .         .         .         .         .         .    g.30334
atgacatctaaaaagcaaaagcttaaattacttttctcaaacatgtcattaatgcaaaac    c.*1620

         .         .         .         .         .         .    g.30394
attccattctgtttatatattactatgacctttggctttaagaggaccaaaacaaaattc    c.*1680

         .         .         .         .         .         .    g.30454
tttgtggctccagcccagattaattctgaaaaggaactttaatggagtaagtgattttcc    c.*1740

         .         .         .         .         .         .    g.30514
tgtcatctgtgtcttcggagggaagagaaatgatttgtaaattgtataaaggcagttctt    c.*1800

         .         .         .         .         .         .    g.30574
tccactttaaaagcctctcaaatgtttctgggctgaaaacaatttttggaggcgtgaaga    c.*1860

         .         .         .         .         .         .    g.30634
gtcaaaactgtcacagtgactgggatatatcaaacacttaaccccgacatctttaccttg    c.*1920

         .         .         .         .         .         .    g.30694
aaatttctaggaaaacattacacaacatgagttacatgaatgacatcagttactgtagca    c.*1980

         .         .         .         .         .         .    g.30754
ttaggtttttccatagttatggtctttgttttgttttgtagagacagggtctccctatgt    c.*2040

         .         .         .         .         .              g.30807
tgcccaggctggtttagaactcctgggctccagtgatcctcccacttcagcct           c.*2093


Powered by LOVD v.3.0 Build 11
©2004-2014 Leiden University Medical Center