mutS homolog 6 (E. coli) (MSH6) - 2547 nt intron 03 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.17977
gtgggacacggcaagcattcagttgttatttatgttagggtgatgggggaagaaaggggg  c.627+60

         .         .         .         .         .         .  g.18037
agggtgtattaacaagataccttgttttatatatgtgtgtgtatatgtattattttatta  c.627+120

         .         .         .         .         .         .  g.18097
tacatacatgcatacttctgtagttccctggactgtaggataagttaggttacttagaat  c.627+180

         .         .         .         .         .         .  g.18157
ctcaacagctagcatcgtttttacttaggttttcaagcctactggcagggtaagcaagag  c.627+240

         .         .         .         .         .         .  g.18217
gtagtaccattttggtaagaagtagagagctagggacagtaaagatggagtaatatatat  c.627+300

         .         .         .         .         .         .  g.18277
atgagggtatagtcaggccctagaaattaattatccagttttatgctttttataaaaaaa  c.627+360

         .         .         .         .         .         .  g.18337
ctgagatggggtcttgctatgttgcccaggctggtctcaaactcctgagttcaagggatc  c.627+420

         .         .         .         .         .         .  g.18397
tgcccacctgggcctcccaaagtgttgggattacaggcatgagccacagcacccagcccc  c.627+480

         .         .         .         .         .         .  g.18457
agctttatgcttttaattctaaaactttttttgttgtattttgcattcataagaatagat  c.627+540

         .         .         .         .         .         .  g.18517
gttaaataaaccttgaaatacaaccttggctcaaacgttaatggtcatggataaagtgaa  c.627+600

         .         .         .         .         .         .  g.18577
ttaaaacttgttaggggccaggtgtggtggttaatgcctataatcccagcactttaggaa  c.627+660

         .         .         .         .         .         .  g.18637
gctgaggcagttggatgtcctgaggacaggagttcaagaccagcctggccaacacagtga  c.627+720

         .         .         .         .         .         .  g.18697
aaccctgtttctataaaaaatacaaaaattagctgggcgtggtggcacacacctgtagtc  c.627+780

         .         .         .         .         .         .  g.18757
ccaaccacttgggaggctgaggcatgagaattgcttgaacttgggaggcagagggacttg  c.627+840

         .         .         .         .         .         .  g.18817
ggaggcagagggtgtagtgagccaagatcgcaccactgcattccagccagggtgacagag  c.627+900

         .         .         .         .         .         .  g.18877
caagaagactgtcaacaacaacaaaaaatgttatagaagtgaaaaaaattgattaattta  c.627+960

         .         .         .         .         .         .  g.18937
gaacaagcttgtccagtctgtggcccaggatggcgtttaaatcagcccaacacaaatttg  c.627+1020

         .         .         .         .         .         .  g.18997
taaactttcttaaaacattttgtgatttgttgttgttgtttagctcatcagctatcatta  c.627+1080

         .         .         .         .         .         .  g.19057
gcattagtgtattttatgtgtggcctaagacaattcttccagtgtggcccagggaagctg  c.627+1140

         .         .         .         .         .         .  g.19117
aaagatcattatcctctgatctatcatattaatgagctgcatcctaaaagacattcatct  c.627+1200

         .         .         .         .         .         .  g.19177
ataactaagctcagtttcatgttttgttcctttttcaatagataagatagggaatgagca  c.627+1260

         .      g.19191
agttaataaagtgg  c.627+1274

--------------------- middle of intron ---------------------
                                   g.19192        .           g.19204
                                   c.628-1273  gtattttaatttt  c.628-1261

.         .         .         .         .         .           g.19264
aaggttgaaactaaggatcataacattatcagaggtctagaactggatggcagctacaga  c.628-1201

.         .         .         .         .         .           g.19324
gatcatttagcctaatactggtttaacaaataatccgggagatccgtgatatgtgaatgt  c.628-1141

.         .         .         .         .         .           g.19384
gctaggcctgagatgagacagccaattgtggaagagcaaacactagaaccagtataagtt  c.628-1081

.         .         .         .         .         .           g.19444
gcttactgctttcttatgctattaatgagcatatcgcctcctgatatttatgatatatgg  c.628-1021

.         .         .         .         .         .           g.19504
tcatgccaacagctttgtcataaatagaactcccatggcagcaatcacttaatcttgtag  c.628-961

.         .         .         .         .         .           g.19564
ttagaggtggggtctcaccatgttgccgagctggccttgaacttctgggctcagcgattt  c.628-901

.         .         .         .         .         .           g.19624
tctccacaggcacctgctactgtgctcggtgcagcactttgtgtttttgaacataacctc  c.628-841

.         .         .         .         .         .           g.19684
aagatgttattgtcttcatagtaaaacaaaagatgaggcttagaactggatcactttgcc  c.628-781

.         .         .         .         .         .           g.19744
tgtctcttcttacctcctcccagttcaaaatgcttgcatctcttaatagctagcattccc  c.628-721

.         .         .         .         .         .           g.19804
ttggattttgcacatgagctcaaactcaagcctcagcacaatcttttttatagttttagt  c.628-661

.         .         .         .         .         .           g.19864
cttttagccagagtcgacttaccccccatacccactctgcttccttcataatgctgcttt  c.628-601

.         .         .         .         .         .           g.19924
ccctgggcagagaatccttgcccttcttgtattatgtcactttgtggggttggtgtctgc  c.628-541

.         .         .         .         .         .           g.19984
tacacttacagcaagtccagagattttttttccaccacgtttgcaggagaactattggca  c.628-481

.         .         .         .         .         .           g.20044
tggaaaatgacaattgttttaatgtcaagtgaaactgaagttgatgttcattgagaggtt  c.628-421

.         .         .         .         .         .           g.20104
tctaatttctagaggtgggttctttttttggcatatgaagttgcagcatattaagagaat  c.628-361

.         .         .         .         .         .           g.20164
ttacagtagtacagatggggttatcccatccacaacttatgatggggttacataaactaa  c.628-301

.         .         .         .         .         .           g.20224
aaacgtgtttaatacacctaccccaccgaatattgtagcttgggcgtagcctaacctatc  c.628-241

.         .         .         .         .         .           g.20284
tcagacgtgctcagaacacttaaatgttagcctaaagttgggcaagatcatctaacacaa  c.628-181

.         .         .         .         .         .           g.20344
agcctattttataataaggaattgcctatctcatgtaattcatcgaatactgtactaaaa  c.628-121

.         .         .         .         .         .           g.20404
atgaaaaacagtggctgcacgggtaccattataaagtcaaaaaatcataagttgaactgt  c.628-61

.         .         .         .         .         .           g.20464
cttacattatggttttccaaattttgatttgtttttaaatactctttccttgcctggcag  c.628-1


Powered by LOVD v.3.0 Build 11
©2004-2014 Leiden University Medical Center