mutS homolog 6 (E. coli) (MSH6) - 2264 nt intron 04 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.23069
gtaagactttgaacaagcttgttctcaggctttgataagtagtgctgtttgccagctgta  c.3172+60

         .         .         .         .         .         .  g.23129
tattatccctaaaaataagtaataaggtatatatggtacatattttgacatgcatataca  c.3172+120

         .         .         .         .         .         .  g.23189
tatttgcatcctgactaggctgcccacagcaatttaagttacttgaaactcgcttttatc  c.3172+180

         .         .         .         .         .         .  g.23249
ttagtagccctttggcctttcttcagtttttttttttttttttttttttttgagacatgg  c.3172+240

         .         .         .         .         .         .  g.23309
tcttgctctgttgcccaggctagaatatggtgacacaaccatggctactgcagcctcgac  c.3172+300

         .         .         .         .         .         .  g.23369
ctcccaggcttaagtgatctttccacctcagcctcccaagtagctgagattacagatatg  c.3172+360

         .         .         .         .         .         .  g.23429
caccaccatgcatggctaatatttaaatgtttgtagagagatggggtctcactgtgttgc  c.3172+420

         .         .         .         .         .         .  g.23489
caggactggtcttgaactcctgggctcaagtgatcctcctgcctcggcttcccaaagtgc  c.3172+480

         .         .         .         .         .         .  g.23549
tgaggttacaggcatgacccattgcgcctggccctttcttcagtctttaataatcgaaca  c.3172+540

         .         .         .         .         .         .  g.23609
aaaggtttttgtttttagacagtgtcttgctctgttacccaggacagacctctcgtgtca  c.3172+600

         .         .         .         .         .         .  g.23669
gcctcttaggtagctaggatttacaggtaagcaccggcgtgccctgctttatttttttgg  c.3172+660

         .         .         .         .         .         .  g.23729
tgggggaagggggaagggagttgaagcttccctatgttgcccaggctggtcttgaactcc  c.3172+720

         .         .         .         .         .         .  g.23789
tggcctcaagtgatcctccagtctcccaaaagtgctgggattacaggcatgagccaccgc  c.3172+780

         .         .         .         .         .         .  g.23849
tcccggcccaaaagatttttaaatgtgttatacttcatgagacaggctttattttagatc  c.3172+840

         .         .         .         .         .         .  g.23909
gaattttatttatcaataaaaagttgagctttttattatttggtgaatactgtttcaagg  c.3172+900

         .         .         .         .         .         .  g.23969
tgctttgttacactatctgttgatccaacatttaaaaattgttttattacaacctttgca  c.3172+960

         .         .         .         .         .         .  g.24029
tttcagtgaatccatctgcatacaattttaaaagaatcattccttttttctgtagccaaa  c.3172+1020

         .         .         .         .         .         .  g.24089
ttgtcaaagattctttcctacaattgatttttcaaagccctgagttaggaatttacaatt  c.3172+1080

         .         .         .         .         .    g.24141
tggcaaccatctcaacttcataagcaattttgttctttaaatgtcacggcca  c.3172+1132

--------------------- middle of intron ---------------------
          .         .         .         .         .           g.24193
        acattacctggaaccattgctgttttatagtttaggtttatgttgtatattt  c.3173-1081

.         .         .         .         .         .           g.24253
tttttaattttttagagacggggtcttgctgttttcagactggagtacaatgggatgact  c.3173-1021

.         .         .         .         .         .           g.24313
agctcactgcagcctcaaactgctgggttcaagtgattctccttcctcagcctcctgagt  c.3173-961

.         .         .         .         .         .           g.24373
agctgggactacaggtggtcaccatcacacctggctaatttttgtatttttggtagagac  c.3173-901

.         .         .         .         .         .           g.24433
agggtttttcccgtgttggccaggctgttcttgaattcctgacctcaaagcgatctgccc  c.3173-841

.         .         .         .         .         .           g.24493
gccttgatctccgaaagagctgggattacacgcatgagccactgcgcccagccctgtttt  c.3173-781

.         .         .         .         .         .           g.24553
ttttttttttttttttttaaataatggtagtttacttgaatttgtaacacagtaacacaa  c.3173-721

.         .         .         .         .         .           g.24613
aactattttgatctgaacgcaagtatctaatggaacagaataatatacttccttttagtg  c.3173-661

.         .         .         .         .         .           g.24673
tgctgcatttggttactgggtaatttaaaattcttcctcagcacaggtgttcaaaaacca  c.3173-601

.         .         .         .         .         .           g.24733
gtcttcagagattgttttcatatcagtgtgccaactttggcacattctgctaagtaagag  c.3173-541

.         .         .         .         .         .           g.24793
gcttaagtgtagcatgtttctgctgttttgtgtttgttttgttttgttttttgagacaga  c.3173-481

.         .         .         .         .         .           g.24853
gtctctctgtcgcccaggctggagtgcattggtgcgatcttggctcattgcaacctctgc  c.3173-421

.         .         .         .         .         .           g.24913
ctcccaggttcaagtgattctcctgcctcagcctcctgcgtagctgggattacaggcata  c.3173-361

.         .         .         .         .         .           g.24973
tgccacgtgtattaggcactgctaatttctgtatttttagtagagacgaggtttcaccat  c.3173-301

.         .         .         .         .         .           g.25033
gttggtcaggctggtcctgaactgctgacctcgtgaactctgcccgcctaggcctcctga  c.3173-241

.         .         .         .         .         .           g.25093
agtgctgggattacaggcgtgagccaccgtgcctggcctctgctctatcttttagctttc  c.3173-181

.         .         .         .         .         .           g.25153
ccttggcacttctatggtccagatgttagagggtaagtattttgatgggggagatcgttg  c.3173-121

.         .         .         .         .         .           g.25213
gactgtaattgaaagttatgtcttataatgaaatgtgttatataaagaagacctataaaa  c.3173-61

.         .         .         .         .         .           g.25273
cacttaggctgataaaacccccaaacgatgaagcctcacttttaccctctcttttaacag  c.3173-1


Powered by LOVD v.3.0 Build 11
©2004-2014 Leiden University Medical Center