mutS homolog 6 (E. coli) (MSH6) - 1224 nt intron 05 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.25599
gtaactgattcttaaagttttgttatcagaaagtcatttgtgacattaggaataacatac  c.3438+60

         .         .         .         .         .         .  g.25659
ttaggtgatcattttccaaacacagttacataaaagtcagccagtgacttaataggaagc  c.3438+120

         .         .         .         .         .         .  g.25719
aaagggaaattactccctgtgttataaaattgagaattatatttagctgaaacatcgatg  c.3438+180

         .         .         .         .         .         .  g.25779
cttaatgttaaggggaatatatgttaaaaaggggaaggaggtcagtcattcaggtcatga  c.3438+240

         .         .         .         .         .         .  g.25839
ggccctttgacttgaattcatttcctcagaaggtaggtatattcatagtgaacaaaaata  c.3438+300

         .         .         .         .         .         .  g.25899
caaaggctgtatgaaaagatgaaaatgttacaggtttatccttaaattagactcatttgc  c.3438+360

         .         .         .         .         .         .  g.25959
agaaatgcaaatgaggtaagaaagcaaatatagttcatgacctctagcaactgttgaaaa  c.3438+420

         .         .         .         .         .         .  g.26019
ctgctctttagggatgacatgctggcccttttttttttgttgttgccaaggctgaagtgc  c.3438+480

         .         .         .         .         .         .  g.26079
agtggcaccatcacagctcactgcagcctcgaactcccaggttcaacccttcctcctgcc  c.3438+540

         .         .         .         .         .         .  g.26139
tcagcctccccagtagctgggactacagatgtacaccatcatgcctagctcatttttaaa  c.3438+600

         .    g.26151
aaaattttttat  c.3438+612

--------------------- middle of intron ---------------------
                                    g.26152       .           g.26163
                                    c.3439-612  ggcattgtattt  c.3439-601

.         .         .         .         .         .           g.26223
atcttctctttataaccaggggttgaccagccacagaacttgtaaagttttttatatttt  c.3439-541

.         .         .         .         .         .           g.26283
taaaaggttgtaagaaatagtagtagttggctggtccccgctgctctcctgcattatagt  c.3439-481

.         .         .         .         .         .           g.26343
atacttctgttcacctagtttgctagagagaggcagtatagtgtgtatagtgatttccaa  c.3439-421

.         .         .         .         .         .           g.26403
actttttctttaaatcagaatcacctgaaagaatgtgacaacgtgtaaaaaaaaaaaaaa  c.3439-361

.         .         .         .         .         .           g.26463
aggtgcagagattccatcctgacatggattcacttgattggaattgattctaggcatctc  c.3439-301

.         .         .         .         .         .           g.26523
agtagttttaaagagctcctaggtgattctattctggccagcgttgagaatcactagggt  c.3439-241

.         .         .         .         .         .           g.26583
agtgggttggtaagcaggctctgatgttttaaaggccaggtgaggccctatgcctcttgt  c.3439-181

.         .         .         .         .         .           g.26643
ctctcttagcctcaactttctccatgttagcaaatggatttcagaacagaaccaacgtac  c.3439-121

.         .         .         .         .         .           g.26703
atgtgattgtgaaagttgttttagagtgcctagctcttacgtaagggttcataagaaaga  c.3439-61

.         .         .         .         .         .           g.26763
caaaagtttatgaaactgttactaccagtcataaaagaccttttcctccctcattcacag  c.3439-1


Powered by LOVD v.3.0 Build 11
©2004-2014 Leiden University Medical Center