mutS homolog 6 (E. coli) (MSH6) - 590 nt intron 06 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.26941
gtgagttttttgtttcccacttaagttctcattcagtcatttagatgtgataaaagatat  c.3556+60

         .         .         .         .         .         .  g.27001
ttgcttcttgtatatgagccttttaaatctaatatttgatttttctggtgttactttaaa  c.3556+120

         .         .         .         .         .         .  g.27061
aacatcactttttaagaactgcatagtctctctctcttttttttttttttgagatggagt  c.3556+180

         .         .         .         .         .         .  g.27121
ttccctcttgttgcccaagctggagtgcaatggcacgatcttggctcactgcaacctctg  c.3556+240

         .         .         .         .         .       g.27176
cttccaggttcaagtgattctcctgcctcagcctctcgagtagctgggattacag  c.3556+295

--------------------- middle of intron ---------------------
          .         .         .         .         .           g.27231
     gcgcatgccatcacgcccagctaattttttgtatttttagtagaagcggggtttc  c.3557-241

.         .         .         .         .         .           g.27291
accatgttaggctggtctcttaactcctgacctcaggtgatctgcttgcctcggcctccc  c.3557-181

.         .         .         .         .         .           g.27351
aaagtgctgggattacaggcgtgagccaccgtgcccggccaataattgcatagtctctta  c.3557-121

.         .         .         .         .         .           g.27411
atgagatttaatcttttataccaatatgtgtagctcatgatagctatataacctagaaga  c.3557-61

.         .         .         .         .         .           g.27471
tgaatttatgtaatatgatttgcaaaatgagtattcatttgtgatttttttttttttaag  c.3557-1


Powered by LOVD v.3.0 Build 11
©2004-2014 Leiden University Medical Center