mutS homolog 6 (E. coli) (MSH6) - 496 nt intron 07 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.27621
gtaagacattaaacttctcatttgaagactatctatcttaaaaacatttgtacaaataac  c.3646+60

         .         .         .         .         .         .  g.27681
tatttttatagaagattatctgaagtacatttaaacaatatgaatgtttttagagcacgc  c.3646+120

         .         .         .         .         .         .  g.27741
actcaccattgtggcacagaccgatagttggagataaaaggtgatattgtgaaaggtttt  c.3646+180

         .         .         .         .         .         .  g.27801
tgattacccattaattattaggccttacactgtttagttgtaataaaacatttgttatac  c.3646+240

          g.27809
tacgggga  c.3646+248

--------------------- middle of intron ---------------------
                                        g.27810               g.27817
                                        c.3647-248  tgagaaca  c.3647-241

.         .         .         .         .         .           g.27877
ctaataggaggactcaggaagtttatgaccttgagcgatactgtattttctttaaaagaa  c.3647-181

.         .         .         .         .         .           g.27937
acctcactccccatgggctgctaagcagactcgtgtagctaaacaaggcctatttataga  c.3647-121

.         .         .         .         .         .           g.27997
atgcttttagacgtggatgtactaaccgatgttgcttttctgtcctagcatttttgtttt  c.3647-61

.         .         .         .         .         .           g.28057
aattccttttttgttttaattcctttgagttacttccttatgcatattttactttaacag  c.3647-1


Powered by LOVD v.3.0 Build 11
©2004-2014 Leiden University Medical Center