mutS homolog 6 (E. coli) (MSH6) - 93 nt intron 08 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         g.28259
gtatgtgcaaattgtttttttccacaaattcggttttttgagagggc  c.3801+47

--------------------- middle of intron ---------------------
   g.28260          .         .         .         .           g.28305
   c.3802-46  acttctcttgctagcacatgtatcgctaatatttttctttcttaag  c.3802-1


Powered by LOVD v.3.0 Build 11
©2004-2014 Leiden University Medical Center