mutS homolog 6 (E. coli) (MSH6) - 127 nt intron 09 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.28565
gtaactaactaactataatggaattataactaactgaccttaagtttcaaagaaacagta  c.4001+60

      g.28569
aaag  c.4001+64

--------------------- middle of intron ---------------------
                                              g.28570         g.28572
                                              c.4002-63  ggg  c.4002-61

.         .         .         .         .         .           g.28632
aagggatgatgcactatgaaaaaacaaaaaaacttttttttttttttttttaattttaag  c.4002-1


Powered by LOVD v.3.0 Build 11
©2004-2014 Leiden University Medical Center