methylthioadenosine phosphorylase (MTAP) - coding DNA reference sequence

(used for variant description)

(last modified July 4, 2017)


This file was created to facilitate the description of sequence variants on transcript NM_002451.3 in the MTAP gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_032650.1, covering MTAP transcript NM_002451.3.


Please note that introns are available by clicking on the exon numbers above the sequence.
 (upstream sequence)
           .         .         .         .         .                g.5053
        ctccgcactgctcactcccgcgcagtgaggttggcacagccaccgctctgtgg       c.-61

 .         .         .         .         .         .                g.5113
 ctcgcttggttcccttagtcccgagcgctcgcccactgcagattcctttcccgtgcagac       c.-1

          .         .         .    | 02    .         .         .    g.17824
 ATGGCCTCTGGCACCACCACCACCGCCGTGAAG | ATTGGAATAATTGGTGGAACAGGCCTG    c.60
 M  A  S  G  T  T  T  T  A  V  K   | I  G  I  I  G  G  T  G  L      p.20

          .         .         .         .         .         .       g.17884
 GATGATCCAGAAATTTTAGAAGGAAGAACTGAAAAATATGTGGATACTCCATTTGGCAAG       c.120
 D  D  P  E  I  L  E  G  R  T  E  K  Y  V  D  T  P  F  G  K         p.40

  | 03       .         .         .         .         .          | 04 g.20400
  | CCATCTGATGCCTTAATTTTGGGGAAGATAAAAAATGTTGATTGCGTCCTCCTTGCAAG | G c.180
  | P  S  D  A  L  I  L  G  K  I  K  N  V  D  C  V  L  L  A  R  |   p.60

          .         .         .         .         .         .       g.20460
 CATGGAAGGCAGCACACCATCATGCCTTCAAAGGTCAACTACCAGGCGAACATCTGGGCT       c.240
 H  G  R  Q  H  T  I  M  P  S  K  V  N  Y  Q  A  N  I  W  A         p.80

          .         .         .         .         .         .       g.20520
 TTGAAGGAAGAGGGCTGTACACATGTCATAGTGACCACAGCTTGTGGCTCCTTGAGGGAG       c.300
 L  K  E  E  G  C  T  H  V  I  V  T  T  A  C  G  S  L  R  E         p.100

          .         .         .         .        | 05.         .    g.40285
 GAGATTCAGCCCGGCGATATTGTCATTATTGATCAGTTCATTGACAG | GACCACTATGAGA    c.360
 E  I  Q  P  G  D  I  V  I  I  D  Q  F  I  D  R  |  T  T  M  R      p.120

          .         .         .         .         .         .       g.40345
 CCTCAGTCCTTCTATGATGGAAGTCATTCTTGTGCCAGAGGAGTGTGCCATATTCCAATG       c.420
 P  Q  S  F  Y  D  G  S  H  S  C  A  R  G  V  C  H  I  P  M         p.140

          .         .         . | 06       .         .         .    g.57025
 GCTGAGCCGTTTTGCCCCAAAACGAGAGAG | GTTCTTATAGAGACTGCTAAGAAGCTAGGA    c.480
 A  E  P  F  C  P  K  T  R  E   | V  L  I  E  T  A  K  K  L  G      p.160

          .         .         .         .         .         .       g.57085
 CTCCGGTGCCACTCAAAGGGGACAATGGTCACAATCGAGGGACCTCGTTTTAGCTCCCGG       c.540
 L  R  C  H  S  K  G  T  M  V  T  I  E  G  P  R  F  S  S  R         p.180

          .         .         .         .         .         .       g.57145
 GCAGAAAGCTTCATGTTCCGCACCTGGGGGGCGGATGTTATCAACATGACCACAGTTCCA       c.600
 A  E  S  F  M  F  R  T  W  G  A  D  V  I  N  M  T  T  V  P         p.200

          .         .         .         .         .         .       g.57205
 GAGGTGGTTCTTGCTAAGGAGGCTGGAATTTGTTACGCAAGTATCGCCATGGCGACAGAT       c.660
 E  V  V  L  A  K  E  A  G  I  C  Y  A  S  I  A  M  A  T  D         p.220

          .         .         . | 07       .         .         .    g.61697
 TATGACTGCTGGAAGGAGCACGAGGAAGCA | GTTTCGGTGGACCGGGTCTTAAAGACCCTG    c.720
 Y  D  C  W  K  E  H  E  E  A   | V  S  V  D  R  V  L  K  T  L      p.240

          .         .         .         .         .         .       g.61757
 AAAGAAAACGCTAATAAAGCCAAAAGCTTACTGCTCACTACCATACCTCAGATAGGGTCC       c.780
 K  E  N  A  N  K  A  K  S  L  L  L  T  T  I  P  Q  I  G  S         p.260

          .         .         .    | 08    .         .         .    g.64367
 ACAGAATGGTCAGAAACCCTCCATAACCTGAAG | AATATGGCCCAGTTTTCTGTTTTATTA    c.840
 T  E  W  S  E  T  L  H  N  L  K   | N  M  A  Q  F  S  V  L  L      p.280

          .                                                         g.64379
 CCAAGACATTAA                                                       c.852
 P  R  H  X                                                         p.283

          .         .         .         .         .         .       g.64439
 agtagcatggctgcccaggagaaaagaagacattctaattccagtcattttgggaattcc       c.*60

          .         .         .         .         .         .       g.64499
 tgcttaacttgaaaaaaatatgggaaagacatgcagctttcatgcccttgcctatcaaag       c.*120

          .         .         .         .         .         .       g.64559
 agtatgttgtaagaaagacaagacattgtgtgtattagagactcctgaatgatttagaca       c.*180

          .         .         .         .         .         .       g.64619
 acttcaaaatacagaagaaaagcaaatgactagtaaacatgtgggaaaaaatattacatt       c.*240

          .         .         .         .         .         .       g.64679
 ttaagggggaaaaaaaaacccaccattctcttctccccctattaaatttgcaacaataaa       c.*300

          .         .         .         .         .         .       g.64739
 gggtggagggtaatctctactttcctatactgccaaagaatgtgaggaagaaatgggact       c.*360

          .         .         .         .         .         .       g.64799
 ctttggttatttattgatgcgactgtaaattggtacagtatttctggagggcaatttggt       c.*420

          .         .         .         .         .         .       g.64859
 aaaatgcatcaaaagacttaaaaatacggacgtactttgtgctgggaactctacatctag       c.*480

          .         .         .         .         .         .       g.64919
 caatttctctttaaaaccatatcagagatgcatacaaagaattatatataaagaagggtg       c.*540

          .         .         .         .         .         .       g.64979
 tttaataatgatagttataataataaataattgaaacaatctgaatcccttgcaattgga       c.*600

          .         .         .         .         .         .       g.65039
 ggtaaattatgtcttagttataattagattgtgaatcagccaactgaaaatcctttttgc       c.*660

          .         .         .         .         .         .       g.65099
 atatttcaatgtcctaaaaagacacggttgctctatatatgaagtgaaaaaaggatatgg       c.*720

          .         .         .         .         .         .       g.65159
 tagcattttatagtactagttttgctttaaaatgctatgtaaatatacaaaaaaactaga       c.*780

          .         .         .         .         .         .       g.65219
 aagaaatatatataaccttgttattgtatttgggggagggatactgggataatttttatt       c.*840

          .         .         .         .         .         .       g.65279
 ttctttgaatctttctgtgtcttcacatttttctacagtgaatttaatcaaatagtaaag       c.*900

          .         .         .         .         .         .       g.65339
 ttgttgtaaaaataaaagtggatttagaaagatccagttcttgaaaacactgtttctggt       c.*960

          .         .         .         .         .         .       g.65399
 aatgaagcagaatttaagttggtaatattaaggtgaatgtcatttaagggagttacatct       c.*1020

          .         .         .         .         .         .       g.65459
 ttattctgctaaagaagaggatcattgatttctgtacagtcagaacagtacttgggtttg       c.*1080

          .         .         .         .         .         .       g.65519
 caacagctttctgagaaaagctaggtgtttaatagtttaactgaaagtttaactatttaa       c.*1140

          .         .         .         .         .         .       g.65579
 aagactaaatgcacattttatggtatctgatattttaaaaagtaatgtttgattctcctt       c.*1200

          .         .         .         .         .         .       g.65639
 tttatgagttaaattattttatacgagttggtaatttttgctttttaataaagtggaagc       c.*1260

          .         .         .         .         .         .       g.65699
 ttgcttttttaactctttttttattgttattttatagaaatgctttttgttggccgggca       c.*1320

          .         .         .         .         .         .       g.65759
 cagttgctcatccatgtaatcccagcactgtgggaggccgagacgggtggatcacaaggt       c.*1380

          .         .         .         .         .         .       g.65819
 caggagatcgagaccatcctggctaatgcgttgaaactccgtctctactaaaaatacaaa       c.*1440

          .         .         .         .         .         .       g.65879
 aaattagctgggcgtggtggtgggcacctgtagtcccagctactcaggaggctgaggcag       c.*1500

          .         .         .         .         .         .       g.65939
 gagaatggtgtgaacctgggaggtggagcttgcagtgagcagagcttgcagtgagacgag       c.*1560

          .         .         .         .         .         .       g.65999
 cttgtgccactgcactccagcctgggcaacagagtaagactcagtctcaaaaaaaaaaaa       c.*1620

          .         .         .         .         .         .       g.66059
 aagagtgaaatgctttttgtttgcttcagttttttatcatggggagatctttttcctcag       c.*1680

          .         .         .         .         .         .       g.66119
 aattgttttcttttcactgtaggctattacaggatacttcaggatcaagatacagaacct       c.*1740

          .         .         .         .         .         .       g.66179
 tttatttaaagagtttgtaaagtcaatgtgtttgtttgtgtctctgagattgacttcaag       c.*1800

          .         .         .         .         .         .       g.66239
 ataataagctgctaattgtaaacaaaacagttaccctccagtattaatatgactcattag       c.*1860

          .         .         .         .         .         .       g.66299
 tgtgagccatttgggtcaagtatgattatgacccttggacttcctgatgtagtattaaat       c.*1920

          .         .         .         .         .         .       g.66359
 ttcaactctggttatccattagcaatctgtagagaacttaatgaacctgaacccaggctt       c.*1980

          .         .         .         .         .         .       g.66419
 ctctagctctggtaacgtgtgattgttttcactacaatatgatacatagatggtacctta       c.*2040

          .         .         .         .         .         .       g.66479
 cttttcctcattcttaataggtgtctaagaatgtcagggcaaaagtatgggcatttttct       c.*2100

          .         .         .         .         .         .       g.66539
 tgctatgttcagaaagtacagttctctccaacttgcagaggtacttttcttgattaaata       c.*2160

          .         .         .         .         .         .       g.66599
 gccttctctagcaacatcattttcagactaactaaatgaatgcagtatactcttttcttt       c.*2220

          .         .         .         .         .         .       g.66659
 gttctcaatcattcactccttatgcaaagccaatataattttcctcataccttatgcttg       c.*2280

          .         .         .         .         .         .       g.66719
 aggatattgttgaagaacacttcctggaacacttctcacttgtgatgctgtactaatttt       c.*2340

          .         .         .         .         .         .       g.66779
 ttttttttaatttaagctagtatactaagtgaacaccatggtcagttgtgagcattttgg       c.*2400

          .         .         .         .         .         .       g.66839
 tttccgcaaaggatggatggtgagcatcatgggaaagctgtagtttagtgacttagccct       c.*2460

          .         .         .         .         .         .       g.66899
 tagtgattaatagatttgcatgtacatagaagtctttgttggccttataatctgctgtta       c.*2520

          .         .         .         .         .         .       g.66959
 tatttggcatggattttcatggttttgagaatgacatcctggccctgtggtccccgaggg       c.*2580

          .         .         .         .         .         .       g.67019
 tcatggtccttgtgacctggcccctgttcactgcccccttcgctagcacgagttgctgtg       c.*2640

          .         .         .         .         .         .       g.67079
 cagggctggaggtagctaccatggcttgtttcaaggaaggaaactctggtacggtggcac       c.*2700

          .         .         .         .         .         .       g.67139
 cctcaggagtggaggacagtgaacttccttgaagagggagtgactaaggtgacctccaac       c.*2760

          .         .         .         .         .         .       g.67199
 ctgccctgagccagctgccctgcaggtgccacgtgagcctgctctggcatccacaggatg       c.*2820

          .         .         .         .         .         .       g.67259
 ctcctggagcctcttctctggctgctacctcagggcatggttgtggccccaccaacacct       c.*2880

          .         .         .         .         .         .       g.67319
 attttccaaataattattcattcttgtgacagtggcctgaacatgtttttaattttctca       c.*2940

          .         .         .         .         .         .       g.67379
 acaagcatttagccagcacttatccagtgaaacaatttgataaggtttcaaggagtatct       c.*3000

          .         .         .         .         .         .       g.67439
 gatgggttaggaagtcacgaaatgaggagttcttgccacatttgcagagtccctccttga       c.*3060

          .         .         .         .         .         .       g.67499
 taaggtttggcggtgtccccacccaaatctcatgttgaattgtagttcccataatcccca       c.*3120

          .         .         .         .         .         .       g.67559
 catgttgtgggagggacccagtgggaggtaattaaatcatgggggtggttacccccacac       c.*3180

          .         .         .         .         .         .       g.67619
 tgctgttctcatgatactgagttctcacaagtcctgtttgttttataaggggcttttccc       c.*3240

          .         .         .         .         .         .       g.67679
 ccttttgctcaacacttcttcctgccatcatgtgaagaaggacgtgtttgtttccccttc       c.*3300

          .         .         .         .         .         .       g.67739
 tgccacgattgtaagtttcctgaggccttcccagctatgtggaactgtgagttaattaaa       c.*3360

          .         .         .         .         .         .       g.67799
 cctctttcctttataaattacccagtcatgggcagtcctttacagcagcatgagaatgga       c.*3420

          .         .         .         .         .         .       g.67859
 ctaatacactcctcaaatgttttgaagattgttgcaccttggaactaccagtgtgcacac       c.*3480

          .         .         .         .         .         .       g.67919
 aatctggctcaatgtatatattggcccagcaaggcaaagaactgaagttccaggatggaa       c.*3540

          .         .         .         .         .         .       g.67979
 gaacctgtgttctcctcataatagtatagaataattcaagataggcaagaaggacagcag       c.*3600

          .         .         .         .         .         .       g.68039
 taaatgaagaccatggaagaaaagaaggaatgccaaagatcgaggaaatctaccaagact       c.*3660

          .         .         .         .         .         .       g.68099
 agtagggtagtccagaagaagctgtttcagggcctgttgccagctatgcctttgagaacc       c.*3720

          .         .         .         .         .         .       g.68159
 tcgggatcccaaagaatgaggggaatttcttcagaaagacaatctcggcatgcattattt       c.*3780

          .         .         .         .         .         .       g.68219
 ctttgttttgaagattcactcatgttgcatgcatctgtagcttgtgccttttttattgcc       c.*3840

          .         .         .         .         .         .       g.68279
 tagtagtattctgtcatatgcctatcttacaatttgattatctattcacctgttgatgaa       c.*3900

          .         .         .         .         .                 g.68336
 tgtttgaattttttccatttgaggaattttatgaataaagctgctataagcatgaaa          c.*3957

 (downstream sequence)
Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The Methylthioadenosine phosphorylase protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.

Powered by LOVD v.3.0 Build 19
©2004-2017 Leiden University Medical Center