methylthioadenosine phosphorylase (MTAP) - downstream reference sequence


         .         .         .         .         .            . g.68339
tgtttgaattttttccatttgaggaattttatgaataaagctgctataagcatgaaa / tta c.*3960

         .         .         .         .         .         .    g.68399
caagtctttttgtgaacatattttcacttgtgcaaatgcctatactcccaccagtaattt    c.*4020

         .         .         .         .         .         .    g.68459
gtaagaattcttgacaaagcttggtattgtcagcgtttttaattttagccattctattgg    c.*4080

         .         .         .         .         .         .    g.68519
gtatattttgatatctcgtggttttgatttgcatttttctgattaaagatgttgaacttc    c.*4140

         .         .         .         .         .         .    g.68579
ttttcatgtgcttattggccattcacatatttcgtgaactatctgtacaaatatttttgt    c.*4200

         .         .         .         .         .         .    g.68639
ttattaaaaaattagattgttttgttttattattgaatagtaagaattgtttatatattc    c.*4260

         .         .         .         .         .         .    g.68699
tggatacactctttttcagatatgtgtgttgtgactattcttagtctttagcttgccttt    c.*4320

         .         .         .         .         .         .    g.68759
tcattttcttaattatgtctttcaaagaacaagtttttcattttgacgaagcctagttta    c.*4380

         .         .         .         .         .         .    g.68819
tcaattttttttatggttggtgctttttgtgtgttccaagaaatctttgcctactcattt    c.*4440

         .         .         .         .         .         .    g.68879
aattacctgtgtgcccttgtcaaaatcatttaattttgactactcacttaattaccttgc    c.*4500

         .         .         .         .         .         .    g.68939
ctactcatttaattacctgtgtgcccttgtcaaaatttactgtttatctgtgaatctgga    c.*4560

         .         .         .         .         .         .    g.68999
tgatctatttatgtcatttatctatgtgtctcttcttatgccagtaccccactgtcttga    c.*4620

         .         .         .         .         .         .    g.69059
ttattgtggctttatggtgtcttgaaattaagtattgttaagctttgcaatcttttccaa    c.*4680

         .         .         .         .         .         .    g.69119
gattgttttggctataggtcctttctttataaagtttatattaagcttctccatttttct    c.*4740

         .         .         .         .         .         .    g.69179
ttaagaaaaaatctgctggaatggcactgaatttttaggtcgatttgggaagaattgaca    c.*4800

         .         .         .         .         .         .    g.69239
atattgaacctttcaatcgatggacatggtatgtttctgcatttatttgggccttttaaa    c.*4860

         .         .         .         .         .         .    g.69299
atttatctcagcaatattttgtagttttagtgaagaagtcttgtatatatcttttgttaa    c.*4920

         .         .         .         .         .         .    g.69359
atgtattcctaaatattttgtggaaatgttactgtaaatagtactttaatttcattttta    c.*4980

         .         .         .         .         .         .    g.69419
agtttattgctggtatacagaaatatgttttatttttgtatattgactttatattctgta    c.*5040

         .         .         .         .         .         .    g.69479
atcttattaaattcacttagttcagtagtagttcttatttttattttattgcaagtgcct    c.*5100

         .         .         .         .         .         .    g.69539
tagggataccttgtgtacacaatcatgtcatatatgaataacaacagtttaccttttgtt    c.*5160

         .         .         .         .         .         .    g.69599
tcttcttgctttgtcgtaatggctaggaccttcaacctaatgttgaatagaagcggtgtg    c.*5220

         .         .         .         .         .         .    g.69659
tgagttgttactcttgtcttattctcaacagcagaggatagcgtctagtttttcactatt    c.*5280

         .         .         .         .         .         .    g.69719
aaaatatgttagctataggttttttccgtttcatgtttttatcagattgaagatcccttt    c.*5340

         .         .         .         .         .         .    g.69779
tattcctattttgccaagagtgtcatgaatgcatgttgaatttcaccaagtactttttcc    c.*5400

         .         .         .         .         .         .    g.69839
tgcatctgttgagagaatcttgacttttctcttttattttgttaatgtagattctttaat    c.*5460

         .         .         .         .         .         .    g.69899
gttaaactgatcttgcattcctgatataaaccatacttagtcatgatatgttatcccctt    c.*5520

         .         .         .         .         .         .    g.69959
tatataatgctggattcggtttgcaaatattttgtttgatttttgcatctatgctcatga    c.*5580

         .         .         .         .         .         .    g.70019
gacagattggtctgtgattttcctttcttgtaagtcttgtcaggtgtcagggcttggtta    c.*5640

         .         .         .         .         .         .    g.70079
attttgacacatttacaaacatatatttttaagataaaaataaacttcaaaaaaaaaaag    c.*5700

         .         .         .         .         .         .    g.70139
atgacgacagcctgagttgtttatatacagaatttgttaaccaaaaagattgaaaaaggc    c.*5760

         .         .         .         .         .         .    g.70199
tggaacagcaggttacatttgatacctgaaaatattttgcagctataaatgcatcttgga    c.*5820

         .         .         .         .         .         .    g.70259
actgttataggcaaaagcttgggaatggctaaaattctcagtgtcataggatgttttaaa    c.*5880

         .         .         .         .         .         .    g.70319
taaactaaggtacatcaattcaaataagtaatgtgcagttgtcaaaaagaatagatatct    c.*5940

         .                                                      g.70336
gtttatgcaccagtatg                                               c.*5957


Powered by LOVD v.3.0 Build 19
©2004-2017 Leiden University Medical Center