methylthioadenosine phosphorylase (MTAP) - 1194 nt intron 02 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.17944
gttaatatccaacttgtggagacatgttttttagttttttcatttctccttgctggcttg  c.120+60

         .         .         .         .         .         .  g.18004
atttttgaattaaaaaaaaaaaaaagaattgcttttgttttggcagcccagggctgtctg  c.120+120

         .         .         .         .         .         .  g.18064
ctcccagcagagagggccagaagttctgctgttgggttccatcagctgagaaggtgtctg  c.120+180

         .         .         .         .         .         .  g.18124
atgggcgcctcacactttgatgttttgagaaaatggctacttagtatgtaaatcacttct  c.120+240

         .         .         .         .         .         .  g.18184
cattctgttgctggaaatcagatactcatttcagaccacagactcatttcagactgtact  c.120+300

         .         .         .         .         .         .  g.18244
tttcaaatctacattcaaatcttctaatttgtggccaataggtcacaccacactaattag  c.120+360

         .         .         .         .         .         .  g.18304
gggacaggctgatgactaataggatgaattattgttacgaagcggcatttgagtggaaag  c.120+420

         .         .         .         .         .         .  g.18364
aattgttttggggaattagaacatacctgatgttagttgaatgtgtaactgagctagaaa  c.120+480

         .         .         .         .         .         .  g.18424
taaaatgctcctccttttataggagaggttgcttgttctccaagcccatgtcactcagcc  c.120+540

         .         .         .         .         .         g.18481
taggccggggtgagggtgtctgcattctcctaattccatattgctacgtcctctggt  c.120+597

--------------------- middle of intron ---------------------
          .         .         .         .         .           g.18538
   ccatctgtaagatctctctatctggctgtcccaaccaaaccctccttttcagctaaa  c.121-541

.         .         .         .         .         .           g.18598
ttcttaggttgaccttgtgtgctcccagtcctgcagtcatcctggttcattttcttaaac  c.121-481

.         .         .         .         .         .           g.18658
ccctcggttctaagggtctttccagcctttgttacctcaagtcatttccatgatcatctt  c.121-421

.         .         .         .         .         .           g.18718
agacctggttaacacaagcagacatttccagtgctgaattcttagtgtcatgatggtggc  c.121-361

.         .         .         .         .         .           g.18778
ttgttatcctttctgcctttcaccttcacacctgttctcaaacctgcccaataaccttga  c.121-301

.         .         .         .         .         .           g.18838
cacatctaaatttgaccagtctaccatcagagttccctggggtactcgttacaaatagat  c.121-241

.         .         .         .         .         .           g.18898
ctgactaaatggtacctacacaggtgcccatggtaaccttgagtcctgtgaatctatgcc  c.121-181

.         .         .         .         .         .           g.18958
tgcagagggatcaataagtaattgattaaatgattatattgataatcagatcttgcctct  c.121-121

.         .         .         .         .         .           g.19018
tctctaagttgtatcctcagactcttcagattccatgagtcctgttgtggttgaacaatt  c.121-61

.         .         .         .         .         .           g.19078
ataatttacatacctgtttttaaatcactgagttaaatgtcattttttcattgcatgcag  c.121-1


Powered by LOVD v.3.0 Build 19
©2004-2017 Leiden University Medical Center