methylthioadenosine phosphorylase (MTAP) - 1262 nt intron 03 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.19197
gtatggtattttaagctttttggatgttactactaaaggataatttaaatttaacttaaa  c.179+60

         .         .         .         .         .         .  g.19257
ttctggaaagagtaaagatacaggtctgagcttttatatgttggcagaatcagaacatct  c.179+120

         .         .         .         .         .         .  g.19317
tagtaacctttatttacaatgttttatttttggttaagttatattgacttaggagatcaa  c.179+180

         .         .         .         .         .         .  g.19377
agatctcatgctcttgccccttacattgggaaagtagatcagatgactaaaatcaaagct  c.179+240

         .         .         .         .         .         .  g.19437
ctggttttagttctaactgcaagaagaaatgttttgttcatttttttcccccttcttata  c.179+300

         .         .         .         .         .         .  g.19497
aagataaagaaaaacaatgcatcattaatgacctcttgctggtagtagttatatgtctgt  c.179+360

         .         .         .         .         .         .  g.19557
gggaagtaggcttagggcttctgaagtgggttacttgtgtctgtgctgttgtttccttaa  c.179+420

         .         .         .         .         .         .  g.19617
ggaggctggtgctgctccatattacagaggaggccaagtcatttttatcccattgttaga  c.179+480

         .         .         .         .         .         .  g.19677
agttagtcaagatatatgtatgagttctctactgttgtgtaacaaattaccacaaattta  c.179+540

         .         .         .         .         .         .  g.19737
gcagcttaaaatagcacacatcatctcctagttcctgttggtcagaagtctggcacagct  c.179+600

         .         .         .   g.19768
tagccagtcctctgcttggggttgcacaagg  c.179+631

--------------------- middle of intron ---------------------
                  g.19769     .         .         .           g.19799
                  c.180-631  ccccacaaggcatattcaaggactgagtccc  c.180-601

.         .         .         .         .         .           g.19859
catctggagcttgaggtccttgttcaagctcgtgtagttgtaggagaattcactccctag  c.180-541

.         .         .         .         .         .           g.19919
aagttacagggcggaggcctttggctcctagaggtggttcacattccctgccgtgtggcc  c.180-481

.         .         .         .         .         .           g.19979
tgctccacaggctgttcacttgactgcagcttgcttcttgctattaggatatggcaaagg  c.180-421

.         .         .         .         .         .           g.20039
tgctagaagtcacctccatggttaagctgtaccttgcaagcatgcaggagtccggcagga  c.180-361

.         .         .         .         .         .           g.20099
gaatctcctatgcatgcttgcaaggtagagcctaatcgtgggagtgacttatagcacgtt  c.180-301

.         .         .         .         .         .           g.20159
taccatttttctattggctgaatgcaagtcccaggttcactgatcctttatacagagcat  c.180-241

.         .         .         .         .         .           g.20219
gacagtggggtcctcactagggtctgtctgccactctacatatttgaaacaggagtggct  c.180-181

.         .         .         .         .         .           g.20279
tctcagaatccagtgaacctaaattttagttttagttgctcactggactgggttctagga  c.180-121

.         .         .         .         .         .           g.20339
gaccccctgtgttagtctgtggtcattgctagagaatcacttaattttttctagactcta  c.180-61

.         .         .         .         .         .           g.20399
ggagaaaacagttggtggtgtactcatcacgggttaacaatttcttctctccttccatag  c.180-1


Powered by LOVD v.3.0 Build 19
©2004-2017 Leiden University Medical Center