methylthioadenosine phosphorylase (MTAP) - 19705 nt intron 04 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.20627
gtaagcagtcatacaaaatgctttaggctattgtagctggtcattttcagctcaaatgga  c.347+60

         .         .         .         .         .         .  g.20687
cgacgcgtgggaaccggcagggcaactgggagggcagtgccacagactcgcttgcttttt  c.347+120

         .         .         .         .         .         .  g.20747
ttttttttttttttttttttttggagacggagcctcactctgtctcccaggctggagtgc  c.347+180

         .         .         .         .         .         .  g.20807
agtggcatgaactcagctcactgaaacctccgcctcccaggttcaagcaatgcttctgtc  c.347+240

         .         .         .         .         .         .  g.20867
ttagcctcccgagtagctgggactacaggcacatgccacaatgcccagctaatttttgta  c.347+300

         .         .         .         .         .         .  g.20927
tttttagtagagatggagtttcgtcatattggtcaggctggtcttgaatcaggagatcac  c.347+360

         .         .         .         .         .         .  g.20987
ccgcctccgcctcccaaagcgcaaagtgctgggattacaggcgtgagccactgcacccag  c.347+420

         .         .         .         .         .         .  g.21047
cctgtgttaagcttttcattgtgagtttttgttttttaattttaattgacaaatgataaa  c.347+480

         .         .         .         .         .         .  g.21107
tgtatatatgaggtataacattatattttgatatatgtatgcattgtacaatgattagca  c.347+540

         .         .         .         .         .         .  g.21167
aagctaattaacatattaccccacatatcatctttagtggtgagaacatttgatttttac  c.347+600

         .         .         .         .         .         .  g.21227
tttaacaattttgaaatacataatacgttgtcattagctataatcaccatgcagtataat  c.347+660

         .         .         .         .         .         .  g.21287
ctcaaaaacttattcctcctgtctaactgaaattttgtgctttgatcaacgtctccccaa  c.347+720

         .         .         .         .         .         .  g.21347
accccagcccctggtaacctttctactctttacttctatgagtttgacttagttagattc  c.347+780

         .         .         .         .         .         .  g.21407
cacatataggtgagatcatgcagtatttgtctttccatggctggtttatttcacttaaca  c.347+840

         .         .         .         .         .         .  g.21467
taatgtccaggttcacccatgttgtggcaattgacagagttgcgttctcttttaaggcta  c.347+900

         .         .         .         .         .         .  g.21527
aatggtattctgttgtgtatatataccacattttcttttttttttttttaattgtacttt  c.347+960

         .         .         .         .         .         .  g.21587
taagttctagggtacatgtgcacaacgtgcaggtttgttacatatgtgtacatgtgccat  c.347+1020

         .         .         .         .         .         .  g.21647
gttggtgtgctgcacccattaactcgtcatttacattgggtatatctcctgatgctttcc  c.347+1080

         .         .         .         .         .         .  g.21707
ctccccactcccccaaccccacaagaggccctggtgtgtgatgttccccttcctatgtcc  c.347+1140

         .         .         .         .         .         .  g.21767
aagtgttctcattgttcagttcccacctatgagtcagaacatgcggagtttggttttttg  c.347+1200

         .         .         .         .         .         .  g.21827
ttcttgggatactttgctgagaatgatggtttccagcttcatccatgtccctacaaagga  c.347+1260

         .         .         .         .         .         .  g.21887
caggaactaatccctttttatggctgcgtagtattccatggtgtatatgtgccacatttt  c.347+1320

         .         .         .         .         .         .  g.21947
cttaatccagtctatcattgatggacatttgggttggttccaagtctttgctattgtgaa  c.347+1380

         .         .         .         .         .         .  g.22007
tagtgccgcaataaacatacgtgtgcatgtgcctttatagcagcatgatttataatcctt  c.347+1440

         .         .         .         .         .         .  g.22067
tgggtatatacccagtaatgggatggctgggtcaaatggtatttctagttctagatccat  c.347+1500

         .         .         .         .         .         .  g.22127
gagaaatcgccacactgtcttccacaatggttgaactagttcaccttcccaccagcagtg  c.347+1560

         .         .         .         .         .         .  g.22187
taaaagtgttcctatttctccacatcctctccagcacctgttgtttcctgacattttaat  c.347+1620

         .         .         .         .         .         .  g.22247
gatcaccattctaactggtgtgagatggtatctcattgtggttttgatttgcatttctct  c.347+1680

         .         .         .         .         .         .  g.22307
gatggccagtgatgatgagcattttttcatgtgtcttttggctgcataaatgtcttctat  c.347+1740

         .         .         .         .         .         .  g.22367
tgagaagtgtctgttcatatcttttgcccacattttgatggggttgtttgatttttttct  c.347+1800

         .         .         .         .         .         .  g.22427
tgtaactttgtttgagttctttgtagattctggatattagcccttagtcagatgcgtagg  c.347+1860

         .         .         .         .         .         .  g.22487
ttgcaaaaattttctcccattctgtaggttgcctgttcactctgatggtagtttcttttg  c.347+1920

         .         .         .         .         .         .  g.22547
ctgtgcagaagctctttagtttaattagatcccatttgtcaattttggcttttgttgcca  c.347+1980

         .         .         .         .         .         .  g.22607
ttgcttttggtgttttagtcatgaagtccttccccatgcctatgtcctgaatggtattgc  c.347+2040

         .         .         .         .         .         .  g.22667
ctaggttttcttctagggtttttatggttttaggtctaacatttaagtctttaatctatc  c.347+2100

         .         .         .         .         .         .  g.22727
ttgaattaatttttgtataaggtgtaaagaaaggatccagtttcagctttctacacatgg  c.347+2160

         .         .         .         .         .         .  g.22787
ctagccagttttcccagcaccatttatgaaatagggaatcctttccccatttcttgtttt  c.347+2220

         .         .         .         .         .         .  g.22847
tgtcaggtttgtcacagatcagatgcttgtagatgtgtggtattatttctgagggctctg  c.347+2280

         .         .         .         .         .         .  g.22907
ttctgttccattggtctatatctgttttggtaccagtaccacgctgttttggtgactgta  c.347+2340

         .         .         .         .         .         .  g.22967
gccttgtagtgtagtttgaagtcaggtagtgagatgcctccagctttgttcttttggctt  c.347+2400

         .         .         .         .         .         .  g.23027
aggattgtcttggcaatgttcatggttccatatgaactttaaagtagtttttcccaattc  c.347+2460

         .         .         .         .         .         .  g.23087
tgtgaagaaagccattggtagcttgatggggatggcactgaatctataaattacctatgg  c.347+2520

         .         .         .         .         .         .  g.23147
ccattttcatgatattgattctacctatccatgagcatggaatgttcttccatttgtttg  c.347+2580

         .         .         .         .         .         .  g.23207
tatcctcttttatttcattgagcagtggtttgtagttctccttgaagaggtccttcacaa  c.347+2640

         .         .         .         .         .         .  g.23267
cccttgtaagttggattcctaggtattttattctctttgaagcaattgtgaatgtgagtt  c.347+2700

         .         .         .         .         .         .  g.23327
cactcaagatttggctctctgtttgtctgttattggtgtataagaatgcttgtgattttt  c.347+2760

         .         .         .         .         .         .  g.23387
gcacattgattttgtgtcctgagactttgctgaagttgcttttcatcttaaggagatttt  c.347+2820

         .         .         .         .         .         .  g.23447
gggctgagacgatggggttttctaaatatacagtcatgtcatctgcaaacaaggacaatt  c.347+2880

         .         .         .         .         .         .  g.23507
tgattactcttttcctaattgaataccctttacatctttctcctgcctgattgccctggc  c.347+2940

         .         .         .         .         .         .  g.23567
cagaacttccagcactgtgttgaataggagtggtgagagagggcatccctgtcttgtgcc  c.347+3000

         .         .         .         .         .         .  g.23627
agttttcaaagggaatgcttccagtttttgcccattcagtatgatattggctgtggggtt  c.347+3060

         .         .         .         .         .         .  g.23687
gtcataaatagctcttattattttgagctacgtcccatcaatacctaacttattgagagt  c.347+3120

         .         .         .         .         .         .  g.23747
ttttagcatgaagggctgttgaattttgtcaaaggcctattctgcatctattgagataat  c.347+3180

         .         .         .         .         .         .  g.23807
catgtagtttttgtctttggttctgtttatatgctggattatgtttattgatttgcgtat  c.347+3240

         .         .         .         .         .         .  g.23867
gttgaaccagccttgcatcccagggatgaagcccacttgatgatggtggataagcttttt  c.347+3300

         .         .         .         .         .         .  g.23927
gatgtgctgctggattcagtttgccagtattttattgaggatttttgcatcgatgttcat  c.347+3360

         .         .         .         .         .         .  g.23987
cagggatattggtctaaaattgtcttttttggttgtgtctctgccaggctttggtatcag  c.347+3420

         .         .         .         .         .         .  g.24047
gatgatgctggcctcataaaatgagttagggaggattccctctttttttattgattggaa  c.347+3480

         .         .         .         .         .         .  g.24107
tagtttcagaaggaatggtaccagctcctccttgtacctctggtagaattcggctgtgaa  c.347+3540

         .         .         .         .         .         .  g.24167
tccatctggtcctggactttttttggttggtaggctattaattattgcctcaacttcaga  c.347+3600

         .         .         .         .         .         .  g.24227
gcctgtttgttattggtctattcagggattcaatttcttcctggtttagtcttgggaggg  c.347+3660

         .         .         .         .         .         .  g.24287
tgtgtgtgtccaggaatttatccatttcttctagattttctagtttatttgcatagaagt  c.347+3720

         .         .         .         .         .         .  g.24347
gtttatagtatgctctgatggtagtttgtatttctgtgggatcggtggtgatatcccctt  c.347+3780

         .         .         .         .         .         .  g.24407
tatcattttttattgcatctatttgattcttctctcttttcttctttattagtcttgcta  c.347+3840

         .         .         .         .         .         .  g.24467
gtggtctatcaattttgttgatcctttcagaaaaccaactcctggattcattgatttttt  c.347+3900

         .         .         .         .         .         .  g.24527
gatgggttttttgtgtctctatctccttcagttcttctctgatcttagttatttcttgtc  c.347+3960

         .         .         .         .         .         .  g.24587
ttctgctagcttttgaatgtgtttgctcttgcttctctagttcttttcattgtgatgtta  c.347+4020

         .         .         .         .         .         .  g.24647
gggtgtcaattttagatctctcttgctttctcttgtgggcatttagtgctataaatttcc  c.347+4080

         .         .         .         .         .         .  g.24707
ctctacacactgctttaaatgtgtcccagagattctggtatgttgtgtatttgttctcat  c.347+4140

         .         .         .         .         .         .  g.24767
tggtttcaaagaacatctttatttctgccttcgttttgttatgtacccagtagtcattca  c.347+4200

         .         .         .         .         .         .  g.24827
ggagcaggttcttcaatttccatgtagttgagcagttttgggtgagtttcttaatcctga  c.347+4260

         .         .         .         .         .         .  g.24887
gttctagtttgattgcactgtggtctgagagatagtttgttataatttctgttcttttac  c.347+4320

         .         .         .         .         .         .  g.24947
atttgctgaggagtgctttacttccaactatgtggtcaattttggaataagtgtgatgtg  c.347+4380

         .         .         .         .         .         .  g.25007
gtgccgagaagaatgtatattctgttgatttggggtggagagttctgtagatgtctgtta  c.347+4440

         .         .         .         .         .         .  g.25067
ggtccgcttggtgcagagctgaattcaattcctggatatccttgttaactttctgtctcg  c.347+4500

         .         .         .         .         .         .  g.25127
ttgatctgtctaatgttgacagtggggtgttaaagtctcccattattattgtgtgggagt  c.347+4560

         .         .         .         .         .         .  g.25187
ctaagtctctttgtagatctctaaggacttgctttatgaatctgggctcctgtattgggt  c.347+4620

         .         .         .         .         .         .  g.25247
gcatatagatttaggatagttggctcttcttgttgaattgatccctttaccattatgtaa  c.347+4680

         .         .         .         .         .         .  g.25307
tggccttctttgtctcttttgatctttgttggtttaaagtctgttttatcagagactagg  c.347+4740

         .         .         .         .         .         .  g.25367
attgcaacgactgcctttttttgttttccatttgcttggtagatcttcctccatcccttt  c.347+4800

         .         .         .         .         .         .  g.25427
attttgagcctatgtgtgtctctgcacgtgagttgggtctcctgaatacagcacactgat  c.347+4860

         .         .         .         .         .         .  g.25487
gggtcttgactctttatccaatttgccagtctgtgtcttttaattggagcatttagccca  c.347+4920

         .         .         .         .         .         .  g.25547
tttacatttaaggttaatattgttatgtgtgaatttgatcctgtcactatgatgttagct  c.347+4980

         .         .         .         .         .         .  g.25607
ggttattttggtcgttagttgatgcagtttcttcctagcatcgatggtctttatattttg  c.347+5040

         .         .         .         .         .         .  g.25667
gcatgtttttgcagtggctggtaccagttgttcctttcctccaggagctcttttagggca  c.347+5100

         .         .         .         .         .         .  g.25727
ggcatggtggtgacaaaatcctcagcatttgcttgtctgtaaaggattttatttctcctt  c.347+5160

         .         .         .         .         .         .  g.25787
ctcttatgaagcttagtttggctggatatgaaattctgggttgaaaattcttttctttaa  c.347+5220

         .         .         .         .         .         .  g.25847
gaatgttgaatattggcccccactctcttctggcttgtagagtttctgccgagagatctg  c.347+5280

         .         .         .         .         .         .  g.25907
cttttagtctgatgggcttcccttgtgggtaacccgacctttctctctggctgtccttaa  c.347+5340

         .         .         .         .         .         .  g.25967
cattttttccttcatttcaactttggtgaatctgacaattatgtgtcttggagttgctct  c.347+5400

         .         .         .         .         .         .  g.26027
tctcgaggagtatctttgtggcgttctctgtatttcctgagtttgaatgttggcctgcct  c.347+5460

         .         .         .         .         .         .  g.26087
tgctagattggggaagttctcctggataatatcctgcagactgttttccaacttggttcc  c.347+5520

         .         .         .         .         .         .  g.26147
attctctctgtcactttccggtacaccaatcagatgtagatttggtcttttcacatagtc  c.347+5580

         .         .         .         .         .         .  g.26207
ccatatttcttggaggcttcgttcatttctttttactcttttttctctaaacttctcgct  c.347+5640

         .         .         .         .         .         .  g.26267
tcatttcattcatctgatcttcaatcactgataccctttcttccagttgatggaatcggc  c.347+5700

         .         .         .         .         .         .  g.26327
tactgaggcttgtgcattcgtcacgtagttctcgtactatggttttcagctccatcaggt  c.347+5760

         .         .         .         .         .         .  g.26387
catttaaggacttctctacactggttattctagttagccattcgtctaatcttttttcaa  c.347+5820

         .         .         .         .         .         .  g.26447
ggtttttagcttctttgcattgggttcgaatttccttctttagctcagagaagtttgatt  c.347+5880

         .         .         .         .         .         .  g.26507
gtctgaagccttctctcaactcgtcagtcattctccatccagctttgttccattgctggc  c.347+5940

         .         .         .         .         .         .  g.26567
gaggagctgtgttcctttggagggggagaggtgctctgatttttagaattttcagctttt  c.347+6000

         .         .         .         .         .         .  g.26627
ctgccctattttttccccatctttgtggttttatctacctttggtctttgatgatggtga  c.347+6060

         .         .         .         .         .         .  g.26687
catacagatgtggttttggtgtggatgtcctttctgtttgttagttttccttctaacagt  c.347+6120

         .         .         .         .         .         .  g.26747
caggaccctcagctgcaggtctgttggagtttgctggaggtccactccagaccctgtttg  c.347+6180

         .         .         .         .         .         .  g.26807
cctggatatcagcagtggaggctgcagaacggcgaatgttgctgaacagcaaatgttcct  c.347+6240

         .         .         .         .         .         .  g.26867
gcctgattgttcctctggaagcttcgtctcagaggggtacccagccgtgtgaggtgtcag  c.347+6300

         .         .         .         .         .         .  g.26927
tctgccctactggggggtgcctcacagttagcctactcggggttcagggacccacctgag  c.347+6360

         .         .         .         .         .         .  g.26987
gaggcagtctgtccattctcagatctcaaactctgtgctgggagaaccactactctcttc  c.347+6420

         .         .         .         .         .         .  g.27047
aaagctgtcagacagggacatttaagtctgcagaggtttctgctgccttttgtttggcta  c.347+6480

         .         .         .         .         .         .  g.27107
tgccctgcccccagagttggagtctacagaggcaggcaggcctccttgagctgtggtggg  c.347+6540

         .         .         .         .         .         .  g.27167
ctccacccagttagagcttcccagccactttgtttacctactcaagcctcagcagtggtg  c.347+6600

         .         .         .         .         .         .  g.27227
ggcgcccatcccccagccttgccgccgccttgcagtttgatctcaggctgctgtgctagc  c.347+6660

         .         .         .         .         .         .  g.27287
aataagcgaggctctgtgggcgtgggaccctccgagctatgcacgggatataatctcctg  c.347+6720

         .         .         .         .         .         .  g.27347
gtgtgccgtttgctaagacagttggaaaagcacagtattagggtggcagtgacccgattt  c.347+6780

         .         .         .         .         .         .  g.27407
tccaggtgccgtctgtcaccccttccctttgctaggaaagggaattccttgaccccttac  c.347+6840

         .         .         .         .         .         .  g.27467
gcttcctaggtgaggcgatgcctcaccctgctttggctcacactcgatgggctgcacccg  c.347+6900

         .         .         .         .         .         .  g.27527
ctctccggcacccactgtccgacaagccccagtgagatgaacccggtacctaagttggaa  c.347+6960

         .         .         .         .         .         .  g.27587
atacagaaatcacctgtcttctgcattgctcatgctgggagctgtagactggagctgttc  c.347+7020

         .         .         .         .         .         .  g.27647
ctattaggccatcttggaaccgcctctcccacattttctttatctgttcatctgttgatg  c.347+7080

         .         .         .         .         .         .  g.27707
gacgtttatgttgcttccatatcttggctattgtgaataatgctgcagggaccatggaag  c.347+7140

         .         .         .         .         .         .  g.27767
tgctgatgtctttcttgacgtaaaatttcatttccttatacactctgagatgggattctt  c.347+7200

         .         .         .         .         .         .  g.27827
ggatcatgtggtagttgatattttcagttttttggggaattttagtaatggctgtattaa  c.347+7260

         .         .         .         .         .         .  g.27887
tttatattcctaccagcagtatacaagggttctgtttttgtcacatcctcatcaacactt  c.347+7320

         .         .         .         .         .         .  g.27947
actttgttttgtcattttgataatggccattgtggcctggcacagtggttcacgcctgta  c.347+7380

         .         .         .         .         .         .  g.28007
atcctagcactttgagaggttgaagcaagaggattgcttgagcccagaagtttgagacca  c.347+7440

         .         .         .         .         .         .  g.28067
gcttgggcaacatagtgagaccttgtctctgtaaaaaataaaacaaaaattagccatgtg  c.347+7500

         .         .         .         .         .         .  g.28127
tgttgatatacagccattgtcccagatacttaagagactgaggtgggagaatcgcttgag  c.347+7560

         .         .         .         .         .         .  g.28187
cctgggaggtcaaggctagaatgattcatgaatgcaccactacactccagcctgggtgac  c.347+7620

         .         .         .         .         .         .  g.28247
agcaaaaaagccattcaggtgtgaggtgatatcttattgtggtttttatttgcattttct  c.347+7680

         .         .         .         .         .         .  g.28307
tgatgattagtgatgttgagcatttttcatacagctgttgtccatttatgtgtcttcttt  c.347+7740

         .         .         .         .         .         .  g.28367
tgaggaatgtctattcaagtcctttgcctatttttttaatcaggttgtgtttttagaact  c.347+7800

         .         .         .         .         .         .  g.28427
ttctttcatttagtttccttacgtattttgggtattaaccccttatccgaggtatggttt  c.347+7860

         .         .         .         .         .         .  g.28487
gtaaacatttttttcctatctataggctgtctctttatattatgggaatttttaaacata  c.347+7920

         .         .         .         .         .         .  g.28547
tacacaaaagaataataatcagggactctctaagttcctaattcctagcttcaagagaac  c.347+7980

         .         .         .         .         .         .  g.28607
attttctttttttttttttttaaagagagtataaattagtatttccttagtattagatat  c.347+8040

         .         .         .         .         .         .  g.28667
ctaggaagttctctctattgtctcatgaactttttttttaatagttggtttgttcaaata  c.347+8100

         .         .         .         .         .         .  g.28727
agggtccactcattacacacataagcttaataagccttctagtctggaagattccacctt  c.347+8160

         .         .         .         .         .         .  g.28787
cttttttccttttccttttactgcctatccacattctggatgttactaattgtatcaagt  c.347+8220

         .         .         .         .         .         .  g.28847
gtcatttagtgtcttctcccggcccctgtgtttgctataaactggatttagttctggtgg  c.347+8280

         .         .         .         .         .         .  g.28907
cctgatcagaaccaggtttgaattcttggcaaggatccttccttctgcatcctgtcggaa  c.347+8340

         .         .         .         .         .         .  g.28967
ggcatgtgatgtccagttgtcccttcataatgcgatcgatcaggtgccagaggtgctggg  c.347+8400

         .         .         .         .         .         .  g.29027
gttttgtttattattattattattattattattattattattattatttaactgcacaag  c.347+8460

         .         .         .         .         .         .  g.29087
taatatatattgttcctttacccccccaaaaaaacaacaataatagactgccaaattttt  c.347+8520

         .         .         .         .         .         .  g.29147
ggaccttttctgcatttagaggtagttgaaatcacaagggaaagtggtggtctctaggtc  c.347+8580

         .         .         .         .         .         .  g.29207
agggatcccccacccctgtggcttgttaggaaccgggctgcacagaagaaggtgagccgt  c.347+8640

         .         .         .         .         .         .  g.29267
ggggcgagagcgagcattaccacctgagctccccatcctgtcagatcagcagcagcatta  c.347+8700

         .         .         .         .         .         .  g.29327
gagtctcataggagcaggaacccaattgtgaactgcacgtggaagggatctgtgttgtgc  c.347+8760

         .         .         .         .         .         .  g.29387
actccttatgaaaatctaactaatgcctgatgatctgaggtggaagagtttcatcctgaa  c.347+8820

         .         .         .         .         .         .  g.29447
accatcccctctgaccctctctgtggaaaaattatcttccatgaaatcagtccccggtgc  c.347+8880

         .         .         .         .         .         .  g.29507
caaaaagattaggggcagctgtactagggccaccccctcccctattcctggtagaaataa  c.347+8940

         .         .         .         .         .         .  g.29567
ttgcctctcagaatgctctgggtgaagacaggagcctcctgggctggatggagagtggag  c.347+9000

         .         .         .         .         .         .  g.29627
agtagcgcagagttaaatcatttggggatccttccacaatcccccatccaatcaccctgc  c.347+9060

         .         .         .         .         .         .  g.29687
ctaccacctcagtccatgctgctcctcccatcagttatctctgagcttactgtactcaca  c.347+9120

         .         .         .         .         .         .  g.29747
gcctgctcctagagcttctgctatgggagagagggttgtccagtccaggccactgtggct  c.347+9180

         .         .         .         .         .         .  g.29807
tctgcctttcagggattcattataatttccagtctatcagaagcattcttggttgtttcc  c.347+9240

         .         .         .         .         .         .  g.29867
tgatggaatgaaactgttttgaaattgcccattctgtaggtcagaaatggttgaatatca  c.347+9300

         .         .         .         .         .         .  g.29927
gcagtttcatgtggttcaacctaataaataatggggttagactaaaatggttacatattt  c.347+9360

         .         .         .         .         .         .  g.29987
ctcaccccaagttatgtccttataatgtatttatacctgacattatatatttgtgacctg  c.347+9420

         .         .         .         .         .         .  g.30047
tttccctctaagccatgtgagatcaaagtcactttctgcccagtttgcaccatatcacca  c.347+9480

         .         .         .         .         .         .  g.30107
acacccacaacagttcctggcccatctttgctctgtcagtaatttttgagggcttgaaca  c.347+9540

         .         .         .         .         .         .  g.30167
tagtcatttgaatagagagataggctggagtttgtgttttggagacatcttgatcaaaat  c.347+9600

         .         .         .         .         .         .  g.30227
ctcaatggctgtcaacgtccatgtgtttggaggtaatagtttaagaaaatgattataata  c.347+9660

         .         .         .         .         .         .  g.30287
tgattgctaaatagagtggaatacaaaactccatattcaggatgatccagatgtataaag  c.347+9720

         .         .         .         .         .         .  g.30347
tattacagatgatactgtaaagtctgaattgggcactgagccttgggttaatctgttact  c.347+9780

         .         .         .         .         .         .  g.30407
taaacagtatgactatacgctgttgcatttcccagatcttttactcacatgtcttaaatg  c.347+9840

         .     g.30420
tagatgtttcaca  c.347+9853

--------------------- middle of intron ---------------------
                                    g.30421       .           g.30432
                                    c.348-9852  tactggctcttt  c.348-9841

.         .         .         .         .         .           g.30492
caagaaagcagttgggtcagaagatggagactagaaagaaaacaggtattgccatcagat  c.348-9781

.         .         .         .         .         .           g.30552
ctggtttcattctatcttagccaggtaaccttaagatcttctactatttttctgtttatg  c.348-9721

.         .         .         .         .         .           g.30612
agacatatggataacctgccctcttaatgtttccttggaagttcaaagtctctaataagt  c.348-9661

.         .         .         .         .         .           g.30672
gccttttgtgggatcttgcatgtgttaaccttctcagtaactgagtgccattattgagag  c.348-9601

.         .         .         .         .         .           g.30732
tgtgtgcatactggctggagggtccactagttgacactactttacaacaacaggaggaaa  c.348-9541

.         .         .         .         .         .           g.30792
gaatctgttaaaagaaggatccctggcagggtgcagtggctcacgcctgtaatcccaaca  c.348-9481

.         .         .         .         .         .           g.30852
ttttgggaggctgaggcaggcagatcacctgaggtcaggagttcgagaccagcctggtca  c.348-9421

.         .         .         .         .         .           g.30912
acatggtgaaaccccgtctttactaaaaatacaaaaaaaaagtagccaggtgtggtgagc  c.348-9361

.         .         .         .         .         .           g.30972
acctgtaatcccagctactcggaaggctgaggcaggagaattgcttgaacccaggaggca  c.348-9301

.         .         .         .         .         .           g.31032
gaggttacagtgaaccgagattgctccattgcactccagcctaggcaacaagagtgaaac  c.348-9241

.         .         .         .         .         .           g.31092
tccatctcaaaaaaaaagaaggatccctaagagaatataatttagcatgaaatctcaatt  c.348-9181

.         .         .         .         .         .           g.31152
tttacattgattacttatttggggtgataacgttttgaatatattaggttagacaagatt  c.348-9121

.         .         .         .         .         .           g.31212
ttaaagttaattttacctgtttctcttttactttttcagtgaccactagaaattttaaaa  c.348-9061

.         .         .         .         .         .           g.31272
ctatgtaggtggctaacatcatattgctgttggatgcatcttttaagtgctgctgccttt  c.348-9001

.         .         .         .         .         .           g.31332
gattgagctgagtgggttccagttaaccaggcttgagcacatatatcattcattatgtgt  c.348-8941

.         .         .         .         .         .           g.31392
ttgaacatctcatagcagaagatgccttgcatatatatcattcattatgtgtttgaacat  c.348-8881

.         .         .         .         .         .           g.31452
ctcatagcagaagatgccttgtggttaatgccctctatgtgttttactgatagcacattt  c.348-8821

.         .         .         .         .         .           g.31512
cttagtaaagtgaatcttggtgtattgagacgggcatctcctacctccacttgctgatgg  c.348-8761

.         .         .         .         .         .           g.31572
catcagatacaaataggctgtgccatttttagcctggggtttcccagagtcatacccaca  c.348-8701

.         .         .         .         .         .           g.31632
gccccaacttgtttaacaggattgtaacatcctgtaaagccaccccgtggattatagaat  c.348-8641

.         .         .         .         .         .           g.31692
tccagggcagctggggcaggagcattgaatcaggaggtttcatcttgactctgtttggcc  c.348-8581

.         .         .         .         .         .           g.31752
ctgtgcaaatcactttacccactacacgttggttctttcttcccaatggagggctgaatt  c.348-8521

.         .         .         .         .         .           g.31812
gcaccatctctctctctcattcttttgttgttttttttttttgtttgtttgtttttttga  c.348-8461

.         .         .         .         .         .           g.31872
gacagtcccactctgttgcccaggctagactgcagtaatgcaatctcggctcactgcaag  c.348-8401

.         .         .         .         .         .           g.31932
tgtgagccactgtgcctggccaggctccttttccctacactgcccgtgtattctctccag  c.348-8341

.         .         .         .         .         .           g.31992
ggacttacctagaaccacacacattggcctattgccgtaagtttgtcagcacgttgtctc  c.348-8281

.         .         .         .         .         .           g.32052
agaaaaaaaaaaaaatcctcatcctaaagtgttcttcaaaggctagcgagattgtttaat  c.348-8221

.         .         .         .         .         .           g.32112
aatacggctattcttattttatagatggccaagctaaagcacatcattttcttttccttc  c.348-8161

.         .         .         .         .         .           g.32172
agtgccagcatgagcagggcggggggaccaacctcagatttaagaaagacatgtggctga  c.348-8101

.         .         .         .         .         .           g.32232
tttttagggttgtttttagaaacattagatttcttctctaataatgaaatatacttttga  c.348-8041

.         .         .         .         .         .           g.32292
aggactctgacaatgctggaagctcttttaagaaaaatgtcattcttatctgaaaatctt  c.348-7981

.         .         .         .         .         .           g.32352
tttttttcttctctctctcatgctacattacagctgatgaagttaaaaagcctgggcata  c.348-7921

.         .         .         .         .         .           g.32412
agaaaaggggagccctgggtgtgactgccctggaaaaagaggtagagagtgcagtgggtt  c.348-7861

.         .         .         .         .         .           g.32472
caagtatgtttgggtatgtgcagtcagtctttgtgtctttctcattcaagtaaattccat  c.348-7801

.         .         .         .         .         .           g.32532
agcaattaaagtgaaaataatcatctttcatttgtgagtagagcatccatagaaagcaac  c.348-7741

.         .         .         .         .         .           g.32592
atatatcttggtctagaacttaaattccaaaagaatgtgttatatttttcattttcccgt  c.348-7681

.         .         .         .         .         .           g.32652
ttttgttgcacagggacgagtttcctgatgcttccttgccataggccctgggctctgtgt  c.348-7621

.         .         .         .         .         .           g.32712
gtagtgttcttcccaaaccaaaaattaaaaataggaaaatcagaatctataccaagaact  c.348-7561

.         .         .         .         .         .           g.32772
ttgtctaggaggcttgtctgcagtaggtttcttcagtgcctatgcctcctgctggattgt  c.348-7501

.         .         .         .         .         .           g.32832
gtttgattaatccatttcttttaacttgtacaaggtccccattgttagagccacaagtca  c.348-7441

.         .         .         .         .         .           g.32892
tttggccactgagggtaaaagatggttaggagtgggatttgttccacttctttgcagcga  c.348-7381

.         .         .         .         .         .           g.32952
ttaaacagtcagtttgaactggggaaagtatttgacctttagtctgtcctaaaagaatgt  c.348-7321

.         .         .         .         .         .           g.33012
catcaggctgtttatacattaaaaggctctcataagatatgtactcccagattcataatt  c.348-7261

.         .         .         .         .         .           g.33072
ttggaacttctctcctatggtacacacccttgtatgtatgcacacctggctctcactgag  c.348-7201

.         .         .         .         .         .           g.33132
tcacttatgggaaactgaagcaagtttttctattaataggggaaaaaagacctcataaaa  c.348-7141

.         .         .         .         .         .           g.33192
gagtcaaagtaaatgagacttagagaaatgtagaagcatgactatgcatcactgggcctt  c.348-7081

.         .         .         .         .         .           g.33252
tgcttagtttttattcatcagccatggagaagaaaggcatgactctttcctgcctcccac  c.348-7021

.         .         .         .         .         .           g.33312
acccaccggacttgtaaagctcgacttcgatgatgcattataaagtggtgcacaggattg  c.348-6961

.         .         .         .         .         .           g.33372
gtttttaatgagatttttgccattggagcaaagcaagactgtttccctgccagctgcttt  c.348-6901

.         .         .         .         .         .           g.33432
attcaagtcatgaggcattttgttgtctcctcctgtacttgtggtacatgggccctccat  c.348-6841

.         .         .         .         .         .           g.33492
tttctagcccagttcttgttagatacctttgcacattcatttgtatgtatggcagaactg  c.348-6781

.         .         .         .         .         .           g.33552
atgatatggcctttctttcacccccaactactaactgtccatgccattaaagatacatgg  c.348-6721

.         .         .         .         .         .           g.33612
acaggggattccagcaatttctacagttgctcttctttctctttaccattaatcctgatg  c.348-6661

.         .         .         .         .         .           g.33672
attgtaggaaatcagtacaccatatttattatgcaaatctaagaaaaacaactagatcta  c.348-6601

.         .         .         .         .         .           g.33732
taaactatttgaaaagatgcccacattgtatttttttgttgtttttttagataggatctt  c.348-6541

.         .         .         .         .         .           g.33792
tctctgttgcccggggtagagtgcagtggcctgatcgcagctcactgtagcctctacctc  c.348-6481

.         .         .         .         .         .           g.33852
ctgggcttaagcaatcctcagcccgtctagtagctaggattacaggaatctgccactgtg  c.348-6421

.         .         .         .         .         .           g.33912
cttggtaattttttttttttaaggagatggggtctcactatgttgcccaggctggtttca  c.348-6361

.         .         .         .         .         .           g.33972
aactcctggcctcaagcagtcttcctgctttggcctccccaaagtgctgggattataggc  c.348-6301

.         .         .         .         .         .           g.34032
atgagccactgcacccagctacatattttttagaaaaggatcagatgagtaggacttgct  c.348-6241

.         .         .         .         .         .           g.34092
caactgctatcactgtcagaaatatctcaaggtgaaacttgcaaacatatcagtaaggag  c.348-6181

.         .         .         .         .         .           g.34152
aaggatgagatttcttttttaatagtcttctttatcaggaatgttttgcagatattgatt  c.348-6121

.         .         .         .         .         .           g.34212
ttttttttttttacaatgagaaaaatatgaccaaaaactgaatattaaaggaagcagagt  c.348-6061

.         .         .         .         .         .           g.34272
gtgattcccggtgctaaacagtttctataaaatgtggctaataacatattggcctgttgt  c.348-6001

.         .         .         .         .         .           g.34332
gcctaaggcctgtgtttgggttatgccttctcaaagaatgcagtggaagaatctcagctt  c.348-5941

.         .         .         .         .         .           g.34392
agaagtgaggacatccagaattctttcctggctgtgccgtgaaattcctttgtcacttag  c.348-5881

.         .         .         .         .         .           g.34452
tgtcctcatctgctaaatgagggtgttgaattgattcctaaaagttctggtatcctcccc  c.348-5821

.         .         .         .         .         .           g.34512
tcttcagattatttcttcaacttattttcttggtagaactgggagaggttcgactttgct  c.348-5761

.         .         .         .         .         .           g.34572
tttgtcacgcattcttactcatcaggaaagtcccgctataaacacagtgctgagggatca  c.348-5701

.         .         .         .         .         .           g.34632
gttatgtcagtctgtttccttctcccagagaccagccctgccttgggcttcccctagaac  c.348-5641

.         .         .         .         .         .           g.34692
tttatgtcatagcataaaggcccgtgtctgggccctgaggttgggagtatgctctgatgt  c.348-5581

.         .         .         .         .         .           g.34752
caagtatttgatcattctctttctgcctcttgatgactagaaagcgttttatggtaaaga  c.348-5521

.         .         .         .         .         .           g.34812
gttacgcaagaagcctttgtttagctctttctctcattgctaaaaatagtaagctgtttt  c.348-5461

.         .         .         .         .         .           g.34872
taacccttactgttcttacttcttcttactcatttccctcactctttagctgagaatgtc  c.348-5401

.         .         .         .         .         .           g.34932
acctccacctttatagagaagacagaaacttaagcataaactcttcaccttccttcacct  c.348-5341

.         .         .         .         .         .           g.34992
tccctttccccagttacttgcgtccctgttctttgtcatcctcttgtctgtagctgtcct  c.348-5281

.         .         .         .         .         .           g.35052
tgaagtggtgtccactattcccctggatgaggttcattcttacgttctgttccataacct  c.348-5221

.         .         .         .         .         .           g.35112
agttgtgttattaacttcccatcatacatccttttattaaaaatcctacactaccagttt  c.348-5161

.         .         .         .         .         .           g.35172
ttgagttcctattaggtgtcacaatcagttaatcccacttacggcatacagcagtcatta  c.348-5101

.         .         .         .         .         .           g.35232
ttccagtttatacttgaagaaacttaggcccttactatgtttctggcactgcttattatc  c.348-5041

.         .         .         .         .         .           g.35292
acagctctagaagacatcttctatctaccttatccttcccttttacaaaaggtgagaaaa  c.348-4981

.         .         .         .         .         .           g.35352
ctgaggcccaaagaggttgttgtcaccacctatgtagagtgaggatttttatttttgtgc  c.348-4921

.         .         .         .         .         .           g.35412
tattgtttagcatgatctcatgaaatataatagaaaataaggggaaactatggtacctgt  c.348-4861

.         .         .         .         .         .           g.35472
ttattgagcagccttccttgactgggatataaacatccattggttttcctcctttttcat  c.348-4801

.         .         .         .         .         .           g.35532
gccaccacaagcactcaggggcactcttgataccagaacagtgggaggatcttagtgata  c.348-4741

.         .         .         .         .         .           g.35592
ttggtccaaattcataagttttcacttctcttttttttgagacaagatctcactctcgcc  c.348-4681

.         .         .         .         .         .           g.35652
caagctggagtacagtggcgccacagctcactgcagcctttacctcccaggctcaggtga  c.348-4621

.         .         .         .         .         .           g.35712
tcttgccacctcagccccccaagtagctgggactacaagggtgtgacaccatacccagct  c.348-4561

.         .         .         .         .         .           g.35772
aattttttgtatgtttttgtagagacagggtttcactatgttgcctgggctgatcttgaa  c.348-4501

.         .         .         .         .         .           g.35832
catctaaactcaagggttccacccaccttggcctcctaaagtgctgggattacatgtgtg  c.348-4441

.         .         .         .         .         .           g.35892
agcctcacttccttctggttatagagacagaattgttccacttcttagtctgatgtttct  c.348-4381

.         .         .         .         .         .           g.35952
gtcagaattttttctcatgactgcctattcacgctgctgtttgattcttgggatatattt  c.348-4321

.         .         .         .         .         .           g.36012
taaatgatgggtagattcacttcccctaaaccgtcctccttatgagcagccgttattctg  c.348-4261

.         .         .         .         .         .           g.36072
ctctgccagtaaattaattgactcacgattctgcatgttggggcttgttgtggatacaga  c.348-4201

.         .         .         .         .         .           g.36132
ccgtattctgaaatgtcctcagaggtcgatgattgtgtttgcttctgccaggggatgggt  c.348-4141

.         .         .         .         .         .           g.36192
gtttgccctcagcttgtttgcaacaccacatttcctcaaaggaaacgtattaactaacag  c.348-4081

.         .         .         .         .         .           g.36252
ctatcttcaagccaatgtaagagtcttgattcaagaaacaacctaccagtcagtctattt  c.348-4021

.         .         .         .         .         .           g.36312
ctaggcttttctccctctctttgaaagtgccagtgttcttcctttcactctcttgaactc  c.348-3961

.         .         .         .         .         .           g.36372
atttttcctgccagcacacatcattttgtctcctttacttttccataggctgtttttttt  c.348-3901

.         .         .         .         .         .           g.36432
tatttgtctactagcttttcttatcacatatccctgcttgacaaccttaagcaatttgtt  c.348-3841

.         .         .         .         .         .           g.36492
ggatacccttgatttgaggcccatcaatatgtcatactttgggattggcagaagaaatgt  c.348-3781

.         .         .         .         .         .           g.36552
ttagaagcatattttccataaatgatagtgacaagtgccaagcacttgcttcatgttgtc  c.348-3721

.         .         .         .         .         .           g.36612
tcattcagttttcacggggactttataaggtaagtgggattactcccgtttaaggaaact  c.348-3661

.         .         .         .         .         .           g.36672
gatataactgaggtgcagagagacgagagtgactttcccagaggcacacagctagtgagt  c.348-3601

.         .         .         .         .         .           g.36732
ggtaaagccagtagataagccagtccctgaaatccgtgttttccagtaggatcccaagct  c.348-3541

.         .         .         .         .         .           g.36792
atggggagataaaaattagtccccttgcctagctagagggctttaaaggttaaagcaaga  c.348-3481

.         .         .         .         .         .           g.36852
ggaagaagcagaccttatcttttagttctgtaagtttggagtgtatcgtgggtctcactg  c.348-3421

.         .         .         .         .         .           g.36912
aaactagaaaaattgtcagcacggctgcattcctttctggaggcttagggtagaatccct  c.348-3361

.         .         .         .         .         .           g.36972
ttccctgcctttgccactcaccttggcatatggccctcatccatcttcagagccagcaat  c.348-3301

.         .         .         .         .         .           g.37032
ggcaatggagtcctcacctctcatcatgctgacattgactcttctgcctccgtcttccac  c.348-3241

.         .         .         .         .         .           g.37092
atgtgaggactcatgtgaagacatgccgcacacctagttaatccagaataacctttctat  c.348-3181

.         .         .         .         .         .           g.37152
tttaaagtcagcttgttagcaaccttaattccatttgctctcttagttcccctttgccat  c.348-3121

.         .         .         .         .         .           g.37212
ctaaagtaatatattcataggttctaagggttagcatgtggacatcttcggaggggccat  c.348-3061

.         .         .         .         .         .           g.37272
tatttgaaatctaaaatggagatgttattgcatcgcagtctattgggaggtagccactgg  c.348-3001

.         .         .         .         .         .           g.37332
aggtttttgcagccttgtttttatatttaagcaagggtgtatatgtgtgtcttagtctgt  c.348-2941

.         .         .         .         .         .           g.37392
tcaggttgatacaacggaataccatagactgggtagcttctaagcaacagaaatttctca  c.348-2881

.         .         .         .         .         .           g.37452
cagtcctggaggctgggaagtccaaaaaaagttgccagcagatttggtgtctggtgagaa  c.348-2821

.         .         .         .         .         .           g.37512
cctactttctcacagatagcaccttcttattgtgtccttacatggtggtagaagggcgac  c.348-2761

.         .         .         .         .         .           g.37572
ctagctctctgggatctcttttataaggggtctgatcccaatcatgagagatctgcctaa  c.348-2701

.         .         .         .         .         .           g.37632
tcacctccaaaaggctccatctcctaataccatcacatcttgtgagtttggatttcagca  c.348-2641

.         .         .         .         .         .           g.37692
taggaattttgggaggacacaaaacttcagaccatagcagtagggatgttgctaatacct  c.348-2581

.         .         .         .         .         .           g.37752
cacgaagaaagaacttaaagaagctgagtaatttgcccaagaccacacaaaaattcattc  c.348-2521

.         .         .         .         .         .           g.37812
gaatccagggacaaaactatatttcctgtgttttctccatgtcactcagaaaattcagca  c.348-2461

.         .         .         .         .         .           g.37872
tgagggagaaatatgattcttaatatagaatcatatttctatattgaaatatgatttcaa  c.348-2401

.         .         .         .         .         .           g.37932
tatagctgttttggctagaacttggaagtgaacaggcaggcttaattgggcaacagtccc  c.348-2341

.         .         .         .         .         .           g.37992
cactttgtggggtgtgatcggcaggcttattccaggcttcttgctgagttataaaacttc  c.348-2281

.         .         .         .         .         .           g.38052
tgatttatctgatagagaccttcagaaggaggactggtgctattaaaattatacacattt  c.348-2221

.         .         .         .         .         .           g.38112
cattctggaatttcttttgagggcatcatccactcccctcagctgtgattgtaaacctca  c.348-2161

.         .         .         .         .         .           g.38172
ttgctcttggtcagaatttcattcagcattaacaatgacacatcctgttatgctgtgcag  c.348-2101

.         .         .         .         .         .           g.38232
gtgtattgctgtttataggaatttaagtttagatcattaaatgtttcaatactgaatgta  c.348-2041

.         .         .         .         .         .           g.38292
ttgacagttaagttgatgacgcagaaaactacaaatagctgggcaaactataagaggtgt  c.348-1981

.         .         .         .         .         .           g.38352
ttctcgtctgcaccttcccttctggtatcttgatagtatagcccaaaaatggttttaagc  c.348-1921

.         .         .         .         .         .           g.38412
ccttgcttctcccccagggctaccctctttgcttgcaccttacaaggttgagtgttgtga  c.348-1861

.         .         .         .         .         .           g.38472
ggccccatctggtgccgactccaattctgtctctagcccagacccacacttgtgagctgc  c.348-1801

.         .         .         .         .         .           g.38532
tatgagttatctgggcatcttggttgacttaatcttcctaacatccttgtaaataggtgg  c.348-1741

.         .         .         .         .         .           g.38592
atgaatactatgttttatgattggaaaatgaagaatcaaaaagatatggcaatttggttt  c.348-1681

.         .         .         .         .         .           g.38652
aagtccacatagctagtagttagggagctttgttgagaaagaaaaatgcatgagaggaaa  c.348-1621

.         .         .         .         .         .           g.38712
ttaagactgtagttaataattatcaggtgcatattaacgttgcatgaagcttaacttaaa  c.348-1561

.         .         .         .         .         .           g.38772
tacatgttattcttaaggttaaaaagttcaaaacaaaggcgggggttccaaggcaaatgg  c.348-1501

.         .         .         .         .         .           g.38832
gtggggatagacaggagatgggcagaggtagatgaaatgcgggtgttatggtgtggaagt  c.348-1441

.         .         .         .         .         .           g.38892
cagttggagtatagccactggaggcttttgtggccctgttcatatcatagttataagtgg  c.348-1381

.         .         .         .         .         .           g.38952
gatgttgctaatgcttgactcatcaaaggctgaaacaaagccagagctgaagttgagtac  c.348-1321

.         .         .         .         .         .           g.39012
gtgtcaccgttttattggttaatctttcaaaaagagaaaagcctctgtttatacaggctg  c.348-1261

.         .         .         .         .         .           g.39072
aaacagtcatttgacctgttcttcaactccatctggaattgctttggggttaacttagca  c.348-1201

.         .         .         .         .         .           g.39132
tttcccctaaagcgcatatgacagtgggttgggaggagctcggatggggtttttgttcct  c.348-1141

.         .         .         .         .         .           g.39192
ccagagcgctgaggccttatttctgagtgaggtggccttggtgccagctaatgccactgt  c.348-1081

.         .         .         .         .         .           g.39252
ttagtgtgtgatgaactagaagtaacaggttaattttggccagtagacttgccagctgtg  c.348-1021

.         .         .         .         .         .           g.39312
taaacggaaccagtgaaactatttctcagtgctgcctcccacccctggaagaggacatca  c.348-961

.         .         .         .         .         .           g.39372
tgttatctacctgcccctgttggcttcccttgacccatctctcccatgctgtcccctcct  c.348-901

.         .         .         .         .         .           g.39432
ccctgtgttactcatcagttcaaatttagaataattgaatgcacagagaaagtggcttgt  c.348-841

.         .         .         .         .         .           g.39492
tctgaaaacttctgacaagaaatttccaggtgacttggtgctagattaattttagcctct  c.348-781

.         .         .         .         .         .           g.39552
cttatggattcaaaactgttttgtcagaagacttgaactaagacactttagaattaatta  c.348-721

.         .         .         .         .         .           g.39612
cggctgggaaaaagaacaatctaaatgaggcagcgaacaaagattcctaaatatggagca  c.348-661

.         .         .         .         .         .           g.39672
agacaagtggctctttatttcagtgggtcactggcatgaaaaaatatagttggggttaca  c.348-601

.         .         .         .         .         .           g.39732
ggcaggaattactcttagagacatgggaattaaatgcaaggtaagtaccttgtttggacc  c.348-541

.         .         .         .         .         .           g.39792
ctgaaactaacaaagcaactgtttaaaaacaaatttttttaagacattggggaaatttgc  c.348-481

.         .         .         .         .         .           g.39852
atctgctctgagtcaaagcctgggatttgtgtttgtgaaaaagctaatagaggaagcaag  c.348-421

.         .         .         .         .         .           g.39912
ttggacacaatttaagaaattgttgaatctgggtgatgtgtatatggtgttaagtatatg  c.348-361

.         .         .         .         .         .           g.39972
attttccacgtctgtgatgatgaaacatttttgtattgacttcttaagtgtcttacctgg  c.348-301

.         .         .         .         .         .           g.40032
cctttctgagcccacagttgagttgcacctgcaatccaaagtggttaccccgtcacggct  c.348-241

.         .         .         .         .         .           g.40092
gccagaccacagacactttaattcttgttgtgcggtgtgttgctgccagcccagagccaa  c.348-181

.         .         .         .         .         .           g.40152
aaaagcggaataccaccctgaagcttttgtaaacaattgtctttagcttatccagaggaa  c.348-121

.         .         .         .         .         .           g.40212
ttgagtctggagtaaagacccaaatattgacctagataaagttgactcaccagccctcgg  c.348-61

.         .         .         .         .         .           g.40272
aggatggaaagatggccttaaaataaaacaaacaaaaaccttttttgctttattttgtag  c.348-1


Powered by LOVD v.3.0 Build 19
©2004-2017 Leiden University Medical Center