methylthioadenosine phosphorylase (MTAP) - 4432 nt intron 06 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.57295
gtaggtggaattcttttctaagcacatatagcatgggtttctgggtgccaatagggtgtc  c.690+60

         .         .         .         .         .         .  g.57355
ttaactgtttgtttctattacgttagtttcagaaagtgcctttctacaaggttttgaagt  c.690+120

         .         .         .         .         .         .  g.57415
tgttaatattttctgtagttccattggaaggtaagaacaaagatcaaaggaaagaaagag  c.690+180

         .         .         .         .         .         .  g.57475
acacttttacccaaggatcagtagtgaaaatagtacattgtaggcaggtagatgtgttga  c.690+240

         .         .         .         .         .         .  g.57535
gaatcatactaagacttgggccttattttcaggataaaggtgtattttgattgccaattt  c.690+300

         .         .         .         .         .         .  g.57595
ctgctgctatgctactgttttttgttttcaagaaggaaaaaaatctattaaccctttcct  c.690+360

         .         .         .         .         .         .  g.57655
catgagagggctgtatgttcacatccatctatttaacgtaccgtggctggatactctgtt  c.690+420

         .         .         .         .         .         .  g.57715
cagcatagaaatgtgacaacaaacagagaagtccttaaggagccgacattctgtcggatg  c.690+480

         .         .         .         .         .         .  g.57775
gagatagaagttaagcaaaccaatataagaaagctaacggttataaagaaatagaatggt  c.690+540

         .         .         .         .         .         .  g.57835
gaggtacaagggtacactaggtcaactgaatagagttgaccagaccaaatatttgaagta  c.690+600

         .         .         .         .         .         .  g.57895
tgagaagccttcctgttttaagtgtgatgggcaagaagggcatgattgagtagagtggaa  c.690+660

         .         .         .         .         .         .  g.57955
aggagggagactggggagaagggagagagaggagggatgcaatacagtagggccaggcca  c.690+720

         .         .         .         .         .         .  g.58015
tacagaccatggtaagggtttcagatggaaggacagtgaggggttcaggcagggaaggca  c.690+780

         .         .         .         .         .         .  g.58075
gcaggatccagctggaatttgaggacactggaacaatgaggtcagcttccaaaacaaaac  c.690+840

         .         .         .         .         .         .  g.58135
aaaacaaaactttaaacatctgtgtaagtacagggtggaatataatgaattccaggtacc  c.690+900

         .         .         .         .         .         .  g.58195
catcacttaggttccacaattagccatggccaatcttgtgtgataggtatgtccctacct  c.690+960

         .         .         .         .         .         .  g.58255
atttctcccctgccctcattgtgaagtaaatattttcctaaaaggtctttttaaaattaa  c.690+1020

         .         .         .         .         .         .  g.58315
gttataaccatgccatcattgtacaaaaataatgatattaatttcttaatataatcaaat  c.690+1080

         .         .         .         .         .         .  g.58375
attcagactattcctttttccttcagtctcataatttttaacaatttgatcaaatcagaa  c.690+1140

         .         .         .         .         .         .  g.58435
tcccttacaatccatatgttgtattttaatgattacctcttgtctcttttaatctaattt  c.690+1200

         .         .         .         .         .         .  g.58495
tcacctctttctctttttattccttgtgttacttgaataaactagatcgttcgtcctgtc  c.690+1260

         .         .         .         .         .         .  g.58555
atttatctcattttaagataaagggacgacaaaactgcagtcacttttgaagtaaggaaa  c.690+1320

         .         .         .         .         .         .  g.58615
acatttaggggtgactttctgagcacatttagggtaagtgacatctccaaagaggcctaa  c.690+1380

         .         .         .         .         .         .  g.58675
tattgtaccaccgttttagagagtttgttttactatctaatgtgtacagtgttttgggtc  c.690+1440

         .         .         .         .         .         .  g.58735
atagatgaacacaggttctttgtttttcatgaattccttatgatgactcttcagtgtaat  c.690+1500

         .         .         .         .         .         .  g.58795
aaactgtttgcttagtactaggatgccttttatgtaagagattcgcaaattattacatta  c.690+1560

         .         .         .         .         .         .  g.58855
agtcacaacataatatcttatttggcagctttggtaacctaaggaacaactcagcctcgt  c.690+1620

         .         .         .         .         .         .  g.58915
aatgtcaagaagctgcttccaattaataggaaactccagcccctgccacaccctgagagc  c.690+1680

         .         .         .         .         .         .  g.58975
ggtttgcttcctgcctgtggctttctgctcagtctaataacatatgtctcctcctttgta  c.690+1740

         .         .         .         .         .         .  g.59035
gaaccagcagtgatttcctttagtagccaaatgaggttggggaaatagtcagctggagct  c.690+1800

         .         .         .         .         .         .  g.59095
actttattgaaaagcagagaaattaagctctgtaagtggaaaggcttgaagacagtgtta  c.690+1860

         .         .         .         .         .         .  g.59155
aatgctacaaggaaggcccacagaaagatggcattatttcagccaatcgtgtgttgcagc  c.690+1920

         .         .         .         .         .         .  g.59215
ctggcatggcaaaaaggatttggagttctctaaacccatcttcagatttgagttgctcca  c.690+1980

         .         .         .         .         .         .  g.59275
tttgcttgtcacattgggcgagttatttcacttgtttactcttctgtagaatgaagccag  c.690+2040

         .         .         .         .         .         .  g.59335
ggctctgggtgaggagtggaggttgtttagtcattgtttagtcagttagaccttgaaaga  c.690+2100

         .         .         .         .         .         .  g.59395
ttactggaagaattaaaccaaatgagatatgtaaaaaagctagtataatgctggcttgta  c.690+2160

         .         .         .         .         .        g.59451
agagggtggtcatcagatggtggctctgatggagtggggggcctgagaggtgggta  c.690+2216

--------------------- middle of intron ---------------------
          .         .         .         .         .           g.59507
    gtatcagggaaaagcatttaaactgcaccttgaagagagggtttattttgggaagg  c.691-2161

.         .         .         .         .         .           g.59567
tcagtaggaaggacattttgggtgaagcccaacagctggaacaaagagaagggaggtcag  c.691-2101

.         .         .         .         .         .           g.59627
tgtctatacagaaataaccagtcacaggaaaaatatataaggaaatgagtaaatacaagg  c.691-2041

.         .         .         .         .         .           g.59687
caaatttcttggatgcttcatgtctgcattcaaagactcagcttaaaacatatcatttac  c.691-1981

.         .         .         .         .         .           g.59747
atgtgcctggcagatacccagcctgtcactgctttgtgttcccatagtagtgcaaactcc  c.691-1921

.         .         .         .         .         .           g.59807
cctctgctacagtgttcatcattttttcctatacacatcttggtgtttgtgggtgggatc  c.691-1861

.         .         .         .         .         .           g.59867
tggactatgcttaaggaaatagaaagatgtaatccttgtgtccctgaatgctggatttct  c.691-1801

.         .         .         .         .         .           g.59927
tcgaagcataggaaggcatgtcaagtactctatctctgatggtaattttgtgttcacttt  c.691-1741

.         .         .         .         .         .           g.59987
cttcaactttttcttatgaagctattttagtcatatacagaagtagctaatagcacgagc  c.691-1681

.         .         .         .         .         .           g.60047
ttccatgaattcagcatctagcttcaaccattatattaacttacaaccaatatgattatt  c.691-1621

.         .         .         .         .         .           g.60107
actcccatcaataattttatccataaacacttcaggaggtatctaacatgagcacattat  c.691-1561

.         .         .         .         .         .           g.60167
cattttcattctccaataataattctttaatatacccagccagaatttaaatttctggtt  c.691-1501

.         .         .         .         .         .           g.60227
aaatgccttaaattattcttttggttgcaagctttttatgaaggaaccagatcatttgtc  c.691-1441

.         .         .         .         .         .           g.60287
ctgttgagtttcccacagtctgaattgctgaaatcatctccttggagtagtttaataggc  c.691-1381

.         .         .         .         .         .           g.60347
ttctctgtcctctgtattgtctataaattggtagctagatttagaaatttaatcagattc  c.691-1321

.         .         .         .         .         .           g.60407
aggtgtcttaaggtagcattttattttttcatcaggaagcacataatgagtggtttattt  c.691-1261

.         .         .         .         .         .           g.60467
gggattttgtttggttcggtttgtgatgttagcagccaatccattaattcactgggagcc  c.691-1201

.         .         .         .         .         .           g.60527
ataaaaatggtggtattttaattccataatatttttctttagtagctggaataattttct  c.691-1141

.         .         .         .         .         .           g.60587
aaggagaaacgtacctgtttggttttccagtgtagcaacagttttaacattgtaatccct  c.691-1081

.         .         .         .         .         .           g.60647
tcggctgtggacatgaagagaacagccacatctttctagaccatattaacccattataca  c.691-1021

.         .         .         .         .         .           g.60707
tctgagatattttctccgataccatattgaaatctgtattagtctgttatcacattgcta  c.691-961

.         .         .         .         .         .           g.60767
tggagaaatacctaaaactgggtaatttataaagaaaagaggtttaattggcttatggtt  c.691-901

.         .         .         .         .         .           g.60827
ctacaggctgtacgggacgtgatgctggcatctgctcagcttctggggaggcctcaggaa  c.691-841

.         .         .         .         .         .           g.60887
acttccaatcatgttggaaggcaaaaggagcgaggcatctcacatggtgggagcaggagc  c.691-781

.         .         .         .         .         .           g.60947
aagagagagtgagaggagaggtgctgtacacttttaaacaatcagatctcacaagaactc  c.691-721

.         .         .         .         .         .           g.61007
actatcagtaaaacagcacctgaggatgctgctaaaccattcgtgagaaatccaacccca  c.691-661

.         .         .         .         .         .           g.61067
tgatccaaccgcctcccaccaggccccacctcccacaattcgacatgagatttggtgagg  c.691-601

.         .         .         .         .         .           g.61127
acacaaatccaaaccataccagaattcatcagtgcttttcagagatgtcactgagtttct  c.691-541

.         .         .         .         .         .           g.61187
ctaggacctccgtgctaggactaagaccatcttgataaatgccgagcttgaactcagggg  c.691-481

.         .         .         .         .         .           g.61247
tttaaacgtagaataaacagacttcacaagtcaggtttttcttagtctgtctggactgtt  c.691-421

.         .         .         .         .         .           g.61307
gtaacaaaataccatagcatgggtggcttctgaataacaagtttatttttcacatttctg  c.691-361

.         .         .         .         .         .           g.61367
taagttgagaagtccaagatcaagggactggcacatttggtgtctagtgagagcccactt  c.691-301

.         .         .         .         .         .           g.61427
tctggtagacagccatcttctcactggaacctcacacggtggaaggggccctcgaagaat  c.691-241

.         .         .         .         .         .           g.61487
agcactggggcctcttttgtaagatcactaatcctatccacgaggactctgccttcatga  c.691-181

.         .         .         .         .         .           g.61547
cctaattgcctcccaaatgcccaacctccaaataccctacattgaggattcggtttcagc  c.691-121

.         .         .         .         .         .           g.61607
agataaatttgaggggacacaaacatttaggctgtagcaaggctggagctcagaaaaatg  c.691-61

.         .         .         .         .         .           g.61667
ttttatgacaagcagtggaattttaagttctagtaacctccagtgctattgtttctctag  c.691-1


Powered by LOVD v.3.0 Build 19
©2004-2017 Leiden University Medical Center