methylthioadenosine phosphorylase (MTAP) - 2550 nt intron 07 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.61850
gtaagtgtcagccatggacaatcaggcatgtctgtagactctctattgtcttcttttctt  c.813+60

         .         .         .         .         .         .  g.61910
acttgcatttcacctttggtcctcatgtattttatgccagcctagatgttttcaacaagt  c.813+120

         .         .         .         .         .         .  g.61970
ttttgtgacatctactactaccataccaaccacttgtgaaactgagtagtcttattttct  c.813+180

         .         .         .         .         .         .  g.62030
ggctggtagtgcaagaccactgaaggctagggttgagagagttttattatctcgtgtacc  c.813+240

         .         .         .         .         .         .  g.62090
agattcttcacattgccctgctctgtagtatccctaagtcttacttcagaagattgatag  c.813+300

         .         .         .         .         .         .  g.62150
tgctttctctgcatatcgcttacattgttgacaaagctattttctctttggcagatccat  c.813+360

         .         .         .         .         .         .  g.62210
tcaaatttgtggcaatcctttaaagccaaaactctgacaatagtaccaaaatggtgccag  c.813+420

         .         .         .         .         .         .  g.62270
aaaatatctgcttaaggttaatcatgcatcaaactaaacagtaattaatgataaaccaac  c.813+480

         .         .         .         .         .         .  g.62330
tctagtattctcagaatataatttaaactaactgataaactcggagttgcatgatttttc  c.813+540

         .         .         .         .         .         .  g.62390
tttgggcactttgtgactcttcttaaccacatagggaaagacttgtctcaaactgatcag  c.813+600

         .         .         .         .         .         .  g.62450
atattgcattctcctactatccaaagaggaccataccccaaagtctcctagaatacacct  c.813+660

         .         .         .         .         .         .  g.62510
gtacttttgggtcttctggtggtggtggagagaggatttgaaaggttgatctaagccctc  c.813+720

         .         .         .         .         .         .  g.62570
cttacctgaattaccacctaggagctctgtaatgagagagccacagttttagtataatga  c.813+780

         .         .         .         .         .         .  g.62630
ggacattgtatggtggtaagtgactgccaatcactgggcatggcagagccttgatttgta  c.813+840

         .         .         .         .         .         .  g.62690
atgtttgctaatttacgtggtacaagtgctccagtacggccagtttcacactactaatgt  c.813+900

         .         .         .         .         .         .  g.62750
gaagccactgatgagttgagaagtgatacacacagctcttgcaagctggtacgaacagaa  c.813+960

         .         .         .         .         .         .  g.62810
tccagcacaccactgtaactaaggtgtctctcagcagttaggactgacggtcaagaatgt  c.813+1020

         .         .         .         .         .         .  g.62870
tggaatttgtagcttatcttccctactaagaaacaaatctattggtttcaacactgtata  c.813+1080

         .         .         .         .         .         .  g.62930
cctaggacctaaatgttatttaatgaataaatgatactcctttcccccatgaagtgtttt  c.813+1140

         .         .         .         .         .         .  g.62990
atcataatatatagagatgcaggaaacccttattattagaattaaaagggaaaaaataca  c.813+1200

         .         .         .         .         .         .  g.63050
tttgagtgcagtcaaatggcacaactggagcttgcataaaaaaacgcatgttggtttgcc  c.813+1260

         .       g.63065
agaaatgtgactcct  c.813+1275

--------------------- middle of intron ---------------------
                                 g.63066          .           g.63080
                                 c.814-1275  acttgtactattgtt  c.814-1261

.         .         .         .         .         .           g.63140
agcaaaatgtcatagaagtttgtttgtttatttgtttgtttgtttgagacggagtctcat  c.814-1201

.         .         .         .         .         .           g.63200
tctgtcacccaggctggagtgcagtggcacgatctcagctcactgcaacctctgcctccc  c.814-1141

.         .         .         .         .         .           g.63260
tggttcaagcgattctcctgcctcagtctcctgagtagctgggattacaggcatggacca  c.814-1081

.         .         .         .         .         .           g.63320
ccatgcccagctagtttttatatttttagtagagactaaacctagtagatgaccaacatg  c.814-1021

.         .         .         .         .         .           g.63380
gtttcatcatgtcggtcaggctggtcttgaactcctgacctcgtgatccacccgctttgg  c.814-961

.         .         .         .         .         .           g.63440
cctcccaaagtgctgggattacaggcatgagccactgcgcccagccaagtttattttttt  c.814-901

.         .         .         .         .         .           g.63500
taagtctcccaactaaccccactttgaccatagtctttcaaaagcttgaagttaatttct  c.814-841

.         .         .         .         .         .           g.63560
caaataatatatttactgttttagctttatttttaagtaaaaatgcttgaagagtagaaa  c.814-781

.         .         .         .         .         .           g.63620
tcagtgttctcctttcctggagcttctgaaattgtaaaattgtgtgattttatttgtatg  c.814-721

.         .         .         .         .         .           g.63680
catttttaaagaggcttagtttacgtagctttcatcggattttcaaaggaggattttata  c.814-661

.         .         .         .         .         .           g.63740
tatatgtgtatatatatacacacatacatacatatacacacacacacatataaaacctaa  c.814-601

.         .         .         .         .         .           g.63800
agagagaaaatgaggaattcctgctctagacaaaactgagaatcttggtcttcatgctac  c.814-541

.         .         .         .         .         .           g.63860
agcattaaggaacaccatactaataatccctttttctggggtagtattgttagcactgaa  c.814-481

.         .         .         .         .         .           g.63920
atgtgtatcattcattccctcactaagtcatttcagaaacacttagcacctgctatacgt  c.814-421

.         .         .         .         .         .           g.63980
caaggtctggtttgcaaagataaagagttgtgatgatgatcctatggtgtttggagatat  c.814-361

.         .         .         .         .         .           g.64040
agacacataaaaatttcaatgatttcttacagtggggtaaggataagggatagaggttgc  c.814-301

.         .         .         .         .         .           g.64100
ataaacaataatccaggctgggggctggtatggcaataagtgattatcagaacaatgctc  c.814-241

.         .         .         .         .         .           g.64160
tgagataagcattattaacctcactttacaggaaagggaggtgaggaaccaagagtttag  c.814-181

.         .         .         .         .         .           g.64220
agtacccgaagttccacatctggttagtgaacttgaaaattttctgtagaatttatttaa  c.814-121

.         .         .         .         .         .           g.64280
agtgtatgtttcctgcgtcctcactttgatctagaaaatcaaaatctgttttttttttta  c.814-61

.         .         .         .         .         .           g.64340
acaaacatctcagtaattacgccaacatgtgaatatcactgcctcctttcttcctttcag  c.814-1


Powered by LOVD v.3.0 Build 19
©2004-2017 Leiden University Medical Center