methylenetetrahydrofolate reductase (NAD(P)H) (MTHFR) - coding DNA reference sequence

(used for variant description)

(last modified July 4, 2018)


This file was created to facilitate the description of sequence variants on transcript NM_005957.4 in the MTHFR gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_013351.1, covering MTHFR transcript NM_005957.4.


Please note that introns are available by clicking on the exon numbers above the sequence.
 (upstream sequence)
                     .         .         .         .                g.5049
            atgacgataaaggcacggcctccaacgagacctgtgggcacggccatgt       c.-181

 .         .         .         .         .         .                g.5109
 tgggggcggggcttccggtcacccgcgccggtggtttccgccctgtaggcccgcctctcc       c.-121

 .         .         .         .         .         .                g.5169
 agcaacctgacacctgcgccgcgccccttcactgcgttccccgcccctgcagcggccaca       c.-61

 .         .         .         .         .       | 02 .             g.7987
 gtggtgcggccggcggccgagcgttctgagtcacccgggactggagg | taggaacccagcc    c.-1

          .         .         .         .         .         .       g.8047
 ATGGTGAACGAAGCCAGAGGAAACAGCAGCCTCAACCCCTGCTTGGAGGGCAGTGCCAGC       c.60
 M  V  N  E  A  R  G  N  S  S  L  N  P  C  L  E  G  S  A  S         p.20

          .         .         .         .         .         .       g.8107
 AGTGGCAGTGAGAGCTCCAAAGATAGTTCGAGATGTTCCACCCCGGGCCTGGACCCCGAG       c.120
 S  G  S  E  S  S  K  D  S  S  R  C  S  T  P  G  L  D  P  E         p.40

          .         .         .         .         .         .       g.8167
 CGGCATGAGAGACTCCGGGAGAAGATGAGGCGGCGATTGGAATCTGGTGACAAGTGGTTC       c.180
 R  H  E  R  L  R  E  K  M  R  R  R  L  E  S  G  D  K  W  F         p.60

          .         .         .         .         .       | 03 .    g.9708
 TCCCTGGAATTCTTCCCTCCTCGAACTGCTGAGGGAGCTGTCAATCTCATCTCAAG | GTTT    c.240
 S  L  E  F  F  P  P  R  T  A  E  G  A  V  N  L  I  S  R  |  F      p.80

          .         .         .         .         .         .       g.9768
 GACCGGATGGCAGCAGGTGGCCCCCTCTACATAGACGTGACCTGGCACCCAGCAGGTGAC       c.300
 D  R  M  A  A  G  G  P  L  Y  I  D  V  T  W  H  P  A  G  D         p.100

          .         .         .         .         .         .       g.9828
 CCTGGCTCAGACAAGGAGACCTCCTCCATGATGATCGCCAGCACCGCCGTGAACTACTGT       c.360
 P  G  S  D  K  E  T  S  S  M  M  I  A  S  T  A  V  N  Y  C         p.120

          .         .         .         .         .         .       g.9888
 GGCCTGGAGACCATCCTGCACATGACCTGCTGCCGTCAGCGCCTGGAGGAGATCACGGGC       c.420
 G  L  E  T  I  L  H  M  T  C  C  R  Q  R  L  E  E  I  T  G         p.140

          .         .         .         .         .      | 04  .    g.10786
 CATCTGCACAAAGCTAAGCAGCTGGGCCTGAAGAACATCATGGCGCTGCGGGGAG | ACCCA    c.480
 H  L  H  K  A  K  Q  L  G  L  K  N  I  M  A  L  R  G  D |   P      p.160

          .         .         .         .         .         .       g.10846
 ATAGGTGACCAGTGGGAAGAGGAGGAGGGAGGCTTCAACTACGCAGTGGACCTGGTGAAG       c.540
 I  G  D  Q  W  E  E  E  E  G  G  F  N  Y  A  V  D  L  V  K         p.180

          .         .         .         .       | 05 .         .    g.14718
 CACATCCGAAGTGAGTTTGGTGACTACTTTGACATCTGTGTGGCAG | GTTACCCCAAAGGC    c.600
 H  I  R  S  E  F  G  D  Y  F  D  I  C  V  A  G |   Y  P  K  G      p.200

          .         .         .         .         .         .       g.14778
 CACCCCGAAGCAGGGAGCTTTGAGGCTGACCTGAAGCACTTGAAGGAGAAGGTGTCTGCG       c.660
 H  P  E  A  G  S  F  E  A  D  L  K  H  L  K  E  K  V  S  A         p.220

          .         .         .         .         .         .       g.14838
 GGAGCCGATTTCATCATCACGCAGCTTTTCTTTGAGGCTGACACATTCTTCCGCTTTGTG       c.720
 G  A  D  F  I  I  T  Q  L  F  F  E  A  D  T  F  F  R  F  V         p.240

          .         .         .         .         .         .       g.14898
 AAGGCATGCACCGACATGGGCATCACTTGCCCCATCGTCCCCGGGATCTTTCCCATCCAG       c.780
 K  A  C  T  D  M  G  I  T  C  P  I  V  P  G  I  F  P  I  Q         p.260

  | 06       .         .         .         .         .         .    g.15815
  | GGCTACCACTCCCTTCGGCAGCTTGTGAAGCTGTCCAAGCTGGAGGTGCCACAGGAGATC    c.840
  | G  Y  H  S  L  R  Q  L  V  K  L  S  K  L  E  V  P  Q  E  I      p.280

          .         .         .         .         .         .       g.15875
 AAGGACGTGATTGAGCCAATCAAAGACAACGATGCTGCCATCCGCAACTATGGCATCGAG       c.900
 K  D  V  I  E  P  I  K  D  N  D  A  A  I  R  N  Y  G  I  E         p.300

          .         .         .         .         .         .       g.15935
 CTGGCCGTGAGCCTGTGCCAGGAGCTTCTGGCCAGTGGCTTGGTGCCAGGCCTCCACTTC       c.960
 L  A  V  S  L  C  Q  E  L  L  A  S  G  L  V  P  G  L  H  F         p.320

          .         .         .         .         .         .       g.15995
 TACACCCTCAACCGCGAGATGGCTACCACAGAGGTGCTGAAGCGCCTGGGGATGTGGACT       c.1020
 Y  T  L  N  R  E  M  A  T  T  E  V  L  K  R  L  G  M  W  T         p.340

          .  | 07      .         .         .         .         .    g.16289
 GAGGACCCCAG | GCGTCCCCTACCCTGGGCTCTCAGCGCCCACCCCAAGCGCCGAGAGGAA    c.1080
 E  D  P  R  |  R  P  L  P  W  A  L  S  A  H  P  K  R  R  E  E      p.360

          .         .         .         .         .         .       g.16349
 GATGTACGTCCCATCTTCTGGGCCTCCAGACCAAAGAGTTACATCTACCGTACCCAGGAG       c.1140
 D  V  R  P  I  F  W  A  S  R  P  K  S  Y  I  Y  R  T  Q  E         p.380

          .         .       | 08 .         .         .         .    g.16599
 TGGGACGAGTTCCCTAACGGCCGCTG | GGGCAATTCCTCTTCCCCTGCCTTTGGGGAGCTG    c.1200
 W  D  E  F  P  N  G  R  W  |  G  N  S  S  S  P  A  F  G  E  L      p.400

          .         .         .         .         .         .       g.16659
 AAGGACTACTACCTCTTCTACCTGAAGAGCAAGTCCCCCAAGGAGGAGCTGCTGAAGATG       c.1260
 K  D  Y  Y  L  F  Y  L  K  S  K  S  P  K  E  E  L  L  K  M         p.420

          .         .         .         .         .         .       g.16719
 TGGGGGGAGGAGCTGACCAGTGAAGAAAGTGTCTTTGAAGTCTTCGTTCTTTACCTCTCG       c.1320
 W  G  E  E  L  T  S  E  E  S  V  F  E  V  F  V  L  Y  L  S         p.440

          .         .        | 09.         .         .         .    g.17047
 GGAGAACCAAACCGGAATGGTCACAAA | GTGACTTGCCTGCCCTGGAACGATGAGCCCCTG    c.1380
 G  E  P  N  R  N  G  H  K   | V  T  C  L  P  W  N  D  E  P  L      p.460

          .         .         .         .         .         .       g.17107
 GCGGCTGAGACCAGCCTGCTGAAGGAGGAGCTGCTGCGGGTGAACCGCCAGGGCATCCTC       c.1440
 A  A  E  T  S  L  L  K  E  E  L  L  R  V  N  R  Q  G  I  L         p.480

          .         .         .         .         .         .       g.17167
 ACCATCAACTCACAGCCCAACATCAACGGGAAGCCGTCCTCCGACCCCATCGTGGGCTGG       c.1500
 T  I  N  S  Q  P  N  I  N  G  K  P  S  S  D  P  I  V  G  W         p.500

          .         .         . | 10       .         .         .    g.18754
 GGCCCCAGCGGGGGCTATGTCTTCCAGAAG | GCCTACTTAGAGTTTTTCACTTCCCGCGAG    c.1560
 G  P  S  G  G  Y  V  F  Q  K   | A  Y  L  E  F  F  T  S  R  E      p.520

          .         .         .         .         .         .       g.18814
 ACAGCGGAAGCACTTCTGCAAGTGCTGAAGAAGTACGAGCTCCGGGTTAATTACCACCTT       c.1620
 T  A  E  A  L  L  Q  V  L  K  K  Y  E  L  R  V  N  Y  H  L         p.540

          .   | 11     .         .         .         .         .    g.19825
 GTCAATGTGAAG | GGTGAAAACATCACCAATGCCCCTGAACTGCAGCCGAATGCTGTCACT    c.1680
 V  N  V  K   | G  E  N  I  T  N  A  P  E  L  Q  P  N  A  V  T      p.560

          .         .         .         .         .         .       g.19885
 TGGGGCATCTTCCCTGGGCGAGAGATCATCCAGCCCACCGTAGTGGATCCCGTCAGCTTC       c.1740
 W  G  I  F  P  G  R  E  I  I  Q  P  T  V  V  D  P  V  S  F         p.580

          .   | 12     .         .         .         .         .    g.20253
 ATGTTCTGGAAG | GACGAGGCCTTTGCCCTGTGGATTGAGCGGTGGGGAAAGCTGTATGAG    c.1800
 M  F  W  K   | D  E  A  F  A  L  W  I  E  R  W  G  K  L  Y  E      p.600

          .         .         .         .         .         .       g.20313
 GAGGAGTCCCCGTCCCGCACCATCATCCAGTACATCCACGACAACTACTTCCTGGTCAAC       c.1860
 E  E  S  P  S  R  T  I  I  Q  Y  I  H  D  N  Y  F  L  V  N         p.620

          .         .         .         .         .         .       g.20373
 CTGGTGGACAATGACTTCCCACTGGACAACTGCCTCTGGCAGGTGGTGGAAGACACATTG       c.1920
 L  V  D  N  D  F  P  L  D  N  C  L  W  Q  V  V  E  D  T  L         p.640

          .         .         .         .         .                 g.20424
 GAGCTTCTCAACAGGCCCACCCAGAATGCGAGAGAAACGGAGGCTCCATGA                c.1971
 E  L  L  N  R  P  T  Q  N  A  R  E  T  E  A  P  X                  p.656

          .         .         .         .         .         .       g.20484
 ccctgcgtcctgacgccctgcgttggagccactcctgtcccgccttcctcctccacagtg       c.*60

          .         .         .         .         .         .       g.20544
 ctgcttctcttgggaactccactctccttcgtgtctctcccaccccggcctccactcccc       c.*120

          .         .         .         .         .         .       g.20604
 cacctgacaatggcagctagactggagtgaggcttccaggctcttcctggacctgagtcg       c.*180

          .         .         .         .         .         .       g.20664
 gccccacatgggaacctagtactctctgctctagccaggagtctgtgctcttttggtggg       c.*240

          .         .         .         .         .         .       g.20724
 gagcacttgcgtcctgcagaggaccacagtgggtggcacctcctgagaaggcgaggagag       c.*300

          .         .         .         .         .         .       g.20784
 tggttgttgccaactaagccctcgaaccaaggcagcctccagagccagcctgggactccc       c.*360

          .         .         .         .         .         .       g.20844
 agtgaacttacacttggagcccgtgcagtacaggcaaaacacgcaagggcatcaggcact       c.*420

          .         .         .         .         .         .       g.20904
 ggtggcatcgtagaagagatgtggcaaagtgctgtacccttccacctcctagaggtgggc       c.*480

          .         .         .         .         .         .       g.20964
 agctgggccccacctacttgtgactgaaggggcacaccactgccctgcctgcccacttag       c.*540

          .         .         .         .         .         .       g.21024
 ccgtccatggcaccagccccctggatgggcattgggctgacacctaccatgctgcttttt       c.*600

          .         .         .         .         .         .       g.21084
 ggcacagttgtctattctgagccttgagagaaaaagtgccccttaagggttgaaggcagt       c.*660

          .         .         .         .         .         .       g.21144
 ctgaacccttgtgcttggtggggctcgtggccttccccttttgcctggctgtggaggcct       c.*720

          .         .         .         .         .         .       g.21204
 gatgctgccccgttccctgtcagaggctaagatgagatttgccagcacaggggccccaga       c.*780

          .         .         .         .         .         .       g.21264
 tctgcctgggcctgtgcagcagcccagcttcctggtgtatttttcaggtaggcccttgtc       c.*840

          .         .         .         .         .         .       g.21324
 ctgccagctgccttcctcatcccctcgtcctgtcccagaggttatctgcctggcctggct       c.*900

          .         .         .         .         .         .       g.21384
 ccccacgagtcacctgcaagccccagggcctgggggcagtgactggcaggtgcagatggg       c.*960

          .         .         .         .         .         .       g.21444
 ctgtttcgtgtagtggaagagcagcctgatggccaagggggtggacgcaattgtgggatg       c.*1020

          .         .         .         .         .         .       g.21504
 tcctctttactcccttcctggcctcactggctggggcagaggggcagccgctaggagaga       c.*1080

          .         .         .         .         .         .       g.21564
 ctgaaagcagcagctaggactgaggagtgggttttattgtccttcagagctcttcaagct       c.*1140

          .         .         .         .         .         .       g.21624
 gtcccctctgtcatcactccctggatgtgtggggcatggttccttccctgggaaggctaa       c.*1200

          .         .         .         .         .         .       g.21684
 gttcagttctgttttttattctatgagaacaagtcacagctgcagctgggccccatgctc       c.*1260

          .         .         .         .         .         .       g.21744
 tgccccaagcccccaaccccgcggtgctctggcggcttcctgtccactctcggggccctt       c.*1320

          .         .         .         .         .         .       g.21804
 ggggcctggcttgctccagggtcttgggctactggcagctcctctccttgggctcctggc       c.*1380

          .         .         .         .         .         .       g.21864
 tgccaggcgttggtgccacttcttaaaggcctggaaccagggaggagaggaaatgctatt       c.*1440

          .         .         .         .         .         .       g.21924
 gttgtgggctttctccggggtctgtgctgtgcctgctagagcaacccctgtacccagctc       c.*1500

          .         .         .         .         .         .       g.21984
 cttttgtccccagggcccctccctctgccccaagcagccagccagtcttgcctaggccaa       c.*1560

          .         .         .         .         .         .       g.22044
 atgcacaagctcagaatagatctgatggtgagctgggaagctgtactcagagcagagcaa       c.*1620

          .         .         .         .         .         .       g.22104
 atgagggagggggcgctcaggacccaggccctccatgggctagtgtgagtggcagccatg       c.*1680

          .         .         .         .         .         .       g.22164
 cctcatgccacaccttcttcgcaaactgatggaccgggtgggcctggcctgagctggggc       c.*1740

          .         .         .         .         .         .       g.22224
 cacaaatcaaagcaagggctccagcatccagcctgtgtgttctgtaatggaactgacccc       c.*1800

          .         .         .         .         .         .       g.22284
 ctcccctgaaaacgaaggggccccggggctggcaagcagggaaagctccacggtgcgtgg       c.*1860

          .         .         .         .         .         .       g.22344
 ctgtggcacagacttctggaaggctggctgagtggaatgcagggaagagggcagtacctg       c.*1920

          .         .         .         .         .         .       g.22404
 ggaaaggacccacccatcttcctgctgctgtaactgctgagccactcgcagtcgcaggat       c.*1980

          .         .         .         .         .         .       g.22464
 ccgctgccaccacgtctgccaggcccatctcaggtgccactccctgagctttggggacag       c.*2040

          .         .         .         .         .         .       g.22524
 ttggcagagaaggcctcttgtgctcacgctcccccgcagtccccagcccttctgcctttc       c.*2100

          .         .         .         .         .         .       g.22584
 tcccccgacactgctgcaccagagtgaaagggctatggcaagggggtgtcatctgaggag       c.*2160

          .         .         .         .         .         .       g.22644
 tattaagaatgcagattcctgggcctgtcccccaaggttttggagtcagtaggtccaagg       c.*2220

          .         .         .         .         .         .       g.22704
 gccatacttttgagaggggtttgggttaagtatgaggtgaaatgggagatggtcagtgtg       c.*2280

          .         .         .         .         .         .       g.22764
 gagaggggtgcacccactcaccagggtccgcaccagctgctctgccccttgggcatccac       c.*2340

          .         .         .         .         .         .       g.22824
 ccagtgctgccatgccactgccaggcacctggcctgctgggaaccccgcagcccgtgaag       c.*2400

          .         .         .         .         .         .       g.22884
 cagtgcctcgaggcaccggcgctgcaggtacttcctcctgatggccaagagcatcgtgac       c.*2460

          .         .         .         .         .         .       g.22944
 ccttcagggccagaaggagggcagagccatgggcctgggcctgcttttccaggatcctgc       c.*2520

          .         .         .         .         .         .       g.23004
 aggaacgagcactggccagagagggcccagctgtagccatggctcaggcaagcccctcag       c.*2580

          .         .         .         .         .         .       g.23064
 cccttgcccccatccctcggacccaccaaactgcacacacagctcctcttaccgtagcct       c.*2640

          .         .         .         .         .         .       g.23124
 ccgtttatgggccttgctttgggctttgcaggctctgggctcagggctggagtgcgctct       c.*2700

          .         .         .         .         .         .       g.23184
 tggtccctggtccctcgtccacaggggcaggcctgggacccagctactctgtccaggcca       c.*2760

          .         .         .         .         .         .       g.23244
 ctgtggccagagctggaaggcagggcagagggaatgttccctgcaccctggaaaggggag       c.*2820

          .         .         .         .         .         .       g.23304
 ttgagtcacaagaggttaaggtgggtccaggaaggcagctgctcttagtgcccgcctagg       c.*2880

          .         .         .         .         .         .       g.23364
 agttgagtacagtgaggagggtggaggaaggtgctgagcttagccttgtgccctgccccc       c.*2940

          .         .         .         .         .         .       g.23424
 atctccccaggcctccagcctctcccggctgcctgccgcccaaagagaaatcacaggggc       c.*3000

          .         .         .         .         .         .       g.23484
 ggggcaggaatgcaaagtgttttctcagaacagctgaaacattccgaagagggaatggat       c.*3060

          .         .         .         .         .         .       g.23544
 ggggagaatggtcaatacacataagaccgtgtcccaaggagctgatttccaggcccctga       c.*3120

          .         .         .         .         .         .       g.23604
 ggactggagaccgcttcacccctgcacttcagacaccgtttgtcccccggggcaaggtct       c.*3180

          .         .         .         .         .         .       g.23664
 ccttactctgagcccaggccgttccccttggcttcctccgtccacccaggctgcactgca       c.*3240

          .         .         .         .         .         .       g.23724
 gtgatggcgcgggaggcaccagctctgtggcctgtgtccagcagctgcgggtctgaagga       c.*3300

          .         .         .         .         .         .       g.23784
 atagccagagaggagcacctgaaccccatgggcttggacttcctggggccccgctgggat       c.*3360

          .         .         .         .         .         .       g.23844
 ttcttcgctgctctagctggcaggacacatcccggcctcttccacccattcccccatgtg       c.*3420

          .         .         .         .         .         .       g.23904
 gctgaagacattccaacaatggggtgggcccataatagttagccctcagtcagttcccgg       c.*3480

          .         .         .         .         .         .       g.23964
 agcacagccctgggagggggctatttctctccccactgaaaacatttcaaagctgagtta       c.*3540

          .         .         .         .         .         .       g.24024
 cttgtctgaggcctcatccctcggaagccgtctgactccagagtctgagcccccggctag       c.*3600

          .         .         .         .         .         .       g.24084
 taccctatagagagggggctctccaaaggggctgctggggcatgtgtgcctgtggcagaa       c.*3660

          .         .         .         .         .         .       g.24144
 aagaggagaccctggaattcagcaccctgggtgccattcccagcgtttagtttctagagg       c.*3720

          .         .         .         .         .         .       g.24204
 cctcagtttctccatcagcttatgggatccttgtctttactgacaagaatggaatagaaa       c.*3780

          .         .         .         .         .         .       g.24264
 tgtaaaagtactctgaaaagcaattgccctgtaacttatctagaaagaaaagaccctgag       c.*3840

          .         .         .         .         .         .       g.24324
 actccagaatctgctgttgccatagccccatatgtgtgaattctgcaactagccaaggct       c.*3900

          .         .         .         .         .         .       g.24384
 agttcctttcaattccatttaaaaaacaaaaaccagcaggtgtggtggctcatggcgtaa       c.*3960

          .         .         .         .         .         .       g.24444
 tgggcctgcccaatgctttgggaggccaaggcaggtagatcgcttgagcccaggagtttg       c.*4020

          .         .         .         .         .         .       g.24504
 agacaagccctggcaacatagtgagatcccatttctacaaaaaaaaaaaaaaaaaaatta       c.*4080

          .         .         .         .         .         .       g.24564
 gccgggtgtggtggcacacgcctgtagtctcagctactcaggtggctgaggtgggaggat       c.*4140

          .         .         .         .         .         .       g.24624
 cgtttgagccctggaggttgaggctgcagtgagctgtgatcgcaccactgcactctggcc       c.*4200

          .         .         .         .         .         .       g.24684
 tgggcgacagagtgagacactgtctgagaacaaaaaacgactgaaaaaaaaaatcacctt       c.*4260

          .         .         .         .         .         .       g.24744
 agctttttctcttagaatcttctctaaaacgtattctttgtggcattctgaaataggatt       c.*4320

          .         .         .         .         .         .       g.24804
 catgatgatgcctgttgatcttagggacactacctcacctgccagtatctttggggctgt       c.*4380

          .         .         .         .         .         .       g.24864
 gtccttcaaggacatgtccccagactgctgtgcagtgtcattttttgtgtttggtttggt       c.*4440

          .         .         .         .         .         .       g.24924
 ggtggcttcttcccccttgctaggctatcaacctcttatcaccacttgttggtgtcagaa       c.*4500

          .         .         .         .         .         .       g.24984
 ctaactgcttctggtctggagagggactgaccgatgcctttgggtagagagaattatgaa       c.*4560

          .         .         .         .         .         .       g.25044
 agaaattttggtatttttctactttatattttctgaggtttctgtaataagcatatttca       c.*4620

          .         .         .         .         .         .       g.25104
 cttttccaataagaaaaaaaaaaacttggcctggcgcggtggctcacacctgtaatccca       c.*4680

          .         .         .         .         .         .       g.25164
 gcactttgggaagtcgaggtgggaggatcacttgagttcaggagttcgagaccagcttgg       c.*4740

          .         .         .         .         .         .       g.25224
 gcaatatggtgaaaccccgtctctactaaaaatacaaaaattagccaggcgtggtggcgt       c.*4800

          .         .         .         .         .         .       g.25284
 gcacttgtagtcccagctactcaggaagctgaggcgggagaatcacttgaacccgggagg       c.*4860

          .         .         .         .         .         .       g.25344
 cagaggttgcagtgagctgagatcactcctctgcttcagcctgggcaattgagccagact       c.*4920

          .         .         .                                     g.25374
 ctgtctcaaaaataaacaaaaaaacttgac                                     c.*4950

 (downstream sequence)
Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The Methylenetetrahydrofolate reductase (NAD(P)H) protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.

Powered by LOVD v.3.0 Build 21
©2004-2018 Leiden University Medical Center