muscle, skeletal, receptor tyrosine kinase (MUSK) - coding DNA reference sequence

(used for variant description)

(last modified December 8, 2017)


This file was created to facilitate the description of sequence variants on transcript NM_005592.3 in the MUSK gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_016016.1, covering MUSK transcript NM_005592.3.


Please note that introns are available by clicking on the exon numbers above the sequence.
 (upstream sequence)
                                                   .                g.5014
                                               gtggagctgctgac       c.-121

 .         .         .         .         .         .                g.5074
 acaaacagtcattagcagacaacccttttgcaacaaagtatgctttaaaatgtaaactgt       c.-61

 .         .         .         .         .         .                g.5134
 ggagccattttccttgcgttgtccagaaggaacttcgtcctgcgtgagcctggattaatc       c.-1

          .         .         .         .         .         .       g.5194
 ATGAGAGAGCTCGTCAACATTCCACTGGTACATATTCTTACTCTGGTTGCCTTCAGCGGA       c.60
 M  R  E  L  V  N  I  P  L  V  H  I  L  T  L  V  A  F  S  G         p.20

          .          | 02        .         .         .         .    g.18944
 ACTGAGAAACTTCCAAAAG | CTCCTGTCATCACCACTCCTCTTGAAACAGTGGATGCCTTA    c.120
 T  E  K  L  P  K  A |   P  V  I  T  T  P  L  E  T  V  D  A  L      p.40

          .         .         .         .         .         .       g.19004
 GTTGAAGAAGTGGCTACTTTCATGTGTGCAGTGGAATCCTACCCCCAGCCTGAGATTTCC       c.180
 V  E  E  V  A  T  F  M  C  A  V  E  S  Y  P  Q  P  E  I  S         p.60

          .         .       | 03 .         .         .         .    g.23380
 TGGACTAGAAATAAAATTCTCATTAA | ACTCTTTGACACCCGGTACAGCATCCGGGAGAAT    c.240
 W  T  R  N  K  I  L  I  K  |  L  F  D  T  R  Y  S  I  R  E  N      p.80

          .         .         .         .         .         .       g.23440
 GGGCAGCTCCTCACCATCCTGAGTGTGGAAGACAGTGATGATGGCATTTACTGCTGCACG       c.300
 G  Q  L  L  T  I  L  S  V  E  D  S  D  D  G  I  Y  C  C  T         p.100

          .         .         .         .         .         | 04    g.31634
 GCCAACAATGGTGTGGGAGGAGCTGTGGAGAGTTGTGGAGCCCTGCAAGTGAAGATGA | AA    c.360
 A  N  N  G  V  G  G  A  V  E  S  C  G  A  L  Q  V  K  M  K |       p.120

          .         .         .         .         .         .       g.31694
 CCTAAAATAACTCGTCCTCCCATAAATGTGAAAATAATAGAGGGATTAAAAGCAGTCCTA       c.420
 P  K  I  T  R  P  P  I  N  V  K  I  I  E  G  L  K  A  V  L         p.140

          .         .         .         .         .         .       g.31754
 CCATGTACTACAATGGGTAATCCCAAACCATCAGTGTCTTGGATAAAGGGAGACAGCCCT       c.480
 P  C  T  T  M  G  N  P  K  P  S  V  S  W  I  K  G  D  S  P         p.160

        | 05 .         .         .         .         .         .    g.33608
 CTCAGG | GAAAATTCCCGAATTGCAGTTCTTGAATCTGGGAGCTTGAGGATTCATAACGTA    c.540
 L  R   | E  N  S  R  I  A  V  L  E  S  G  S  L  R  I  H  N  V      p.180

          .         .         .         .         .         .       g.33668
 CAAAAGGAAGATGCAGGACAGTATCGATGTGTGGCAAAAAACAGCCTCGGGACAGCATAT       c.600
 Q  K  E  D  A  G  Q  Y  R  C  V  A  K  N  S  L  G  T  A  Y         p.200

          .         .         | 06         .         .         .    g.70512
 TCCAAAGTGGTGAAGCTGGAAGTTGAGG | TTTTTGCCAGGATCCTGCGGGCTCCTGAATCC    c.660
 S  K  V  V  K  L  E  V  E  V |   F  A  R  I  L  R  A  P  E  S      p.220

          .         .         .         .         .         .       g.70572
 CACAATGTCACCTTTGGCTCCTTTGTGACCCTGCACTGTACAGCAACAGGCATTCCTGTC       c.720
 H  N  V  T  F  G  S  F  V  T  L  H  C  T  A  T  G  I  P  V         p.240

          .         .         .    | 07    .         .         .    g.83897
 CCCACCATCACCTGGATTGAAAACGGAAATGCT | GTTTCTTCTGGGTCCATTCAAGAGAGT    c.780
 P  T  I  T  W  I  E  N  G  N  A   | V  S  S  G  S  I  Q  E  S      p.260

          .         .         .         .         .         .       g.83957
 GTGAAAGACCGAGTGATTGACTCAAGACTGCAGCTGTTTATCACCAAGCCAGGACTCTAC       c.840
 V  K  D  R  V  I  D  S  R  L  Q  L  F  I  T  K  P  G  L  Y         p.280

          .         .         .         .         .         .       g.84017
 ACATGCATAGCTACCAATAAGCATGGGGAGAAGTTCAGTACTGCCAAGGCTGCAGCCACC       c.900
 T  C  I  A  T  N  K  H  G  E  K  F  S  T  A  K  A  A  A  T         p.300

          .    | 08    . | 09       .         .         .         . g.104089
 ATCAGCATAGCAG | AATGGAG | TAAACCACAGAAAGATAACAAAGGCTACTGCGCCCAGTAC c.960
 I  S  I  A  E |   W  S  |  K  P  Q  K  D  N  K  G  Y  C  A  Q  Y   p.320

          .         .         .         .         .         .       g.104149
 AGAGGGGAGGTGTGTAATGCAGTCCTGGCAAAAGATGCTCTTGTTTTTCTCAACACCTCC       c.1020
 R  G  E  V  C  N  A  V  L  A  K  D  A  L  V  F  L  N  T  S         p.340

          .         .         .         .         .         .       g.104209
 TATGCGGACCCTGAGGAGGCCCAAGAGCTACTGGTCCACACGGCCTGGAATGAACTGAAA       c.1080
 Y  A  D  P  E  E  A  Q  E  L  L  V  H  T  A  W  N  E  L  K         p.360

          .         .         .         .         .         .       g.104269
 GTAGTGAGCCCAGTCTGCCGGCCAGCTGCTGAGGCTTTGTTGTGTAACCACATCTTCCAG       c.1140
 V  V  S  P  V  C  R  P  A  A  E  A  L  L  C  N  H  I  F  Q         p.380

          .         .         .         .     | 10   .         .    g.112033
 GAGTGCAGTCCTGGAGTAGTGCCTACTCCTATTCCCATTTGCAG | AGAGTACTGCTTGGCA    c.1200
 E  C  S  P  G  V  V  P  T  P  I  P  I  C  R  |  E  Y  C  L  A      p.400

          .         .         .         .         .         .       g.112093
 GTAAAGGAGCTCTTCTGCGCAAAAGAATGGCTGGTAATGGAAGAGAAGACCCACAGAGGA       c.1260
 V  K  E  L  F  C  A  K  E  W  L  V  M  E  E  K  T  H  R  G         p.420

          .         .         .         .         .         .       g.112153
 CTCTACAGATCCGAGATGCATTTGCTGTCCGTGCCAGAATGCAGCAAGCTTCCCAGCATG       c.1320
 L  Y  R  S  E  M  H  L  L  S  V  P  E  C  S  K  L  P  S  M         p.440

          .         .         .         . | 11       .         .    g.112881
 CATTGGGACCCCACGGCCTGTGCCAGACTGCCACATCTAG | ATTATAACAAAGAAAACCTA    c.1380
 H  W  D  P  T  A  C  A  R  L  P  H  L  D |   Y  N  K  E  N  L      p.460

      | 12   .         .         .         .         .         .    g.121100
 AAAA | CATTCCCACCAATGACGTCCTCAAAGCCAAGTGTGGACATTCCAAATCTGCCTTCC    c.1440
 K  T |   F  P  P  M  T  S  S  K  P  S  V  D  I  P  N  L  P  S      p.480

          .         .         .         .         .         .       g.121160
 TCCTCCTCTTCTTCCTTCTCTGTCTCACCTACATACTCCATGACTGTAATAATCTCCATC       c.1500
 S  S  S  S  S  F  S  V  S  P  T  Y  S  M  T  V  I  I  S  I         p.500

          .         .         .         .         .         .       g.121220
 ATGTCCAGCTTTGCAATATTTGTGCTTCTTACCATAACTACTCTCTATTGCTGCCGAAGA       c.1560
 M  S  S  F  A  I  F  V  L  L  T  I  T  T  L  Y  C  C  R  R         p.520

          .         .       | 13 .         .         .         .    g.121790
 AGAAAACAATGGAAAAATAAGAAAAG | AGAATCAGCAGCAGTAACCCTCACCACACTGCCT    c.1620
 R  K  Q  W  K  N  K  K  R  |  E  S  A  A  V  T  L  T  T  L  P      p.540

          .         .         .         .         .         .       g.121850
 TCTGAGCTCTTACTAGATAGACTTCATCCCAACCCCATGTACCAGAGGATGCCGCTCCTT       c.1680
 S  E  L  L  L  D  R  L  H  P  N  P  M  Y  Q  R  M  P  L  L         p.560

          .         .         .         .         .         .       g.121910
 CTGAACCCCAAATTGCTCAGCCTGGAGTATCCAAGGAATAACATTGAATATGTGAGAGAC       c.1740
 L  N  P  K  L  L  S  L  E  Y  P  R  N  N  I  E  Y  V  R  D         p.580

          .         .         .         | 14         .         .    g.123941
 ATCGGAGAGGGAGCGTTTGGAAGGGTGTTTCAAGCAAG | GGCACCAGGCTTACTTCCCTAT    c.1800
 I  G  E  G  A  F  G  R  V  F  Q  A  R  |  A  P  G  L  L  P  Y      p.600

          .         .         .         .         .         .       g.124001
 GAACCTTTCACTATGGTGGCAGTAAAGATGCTCAAAGAAGAAGCCTCGGCAGATATGCAA       c.1860
 E  P  F  T  M  V  A  V  K  M  L  K  E  E  A  S  A  D  M  Q         p.620

          .         .         .         .         .         .       g.124061
 GCGGACTTTCAGAGGGAGGCAGCCCTCATGGCAGAATTTGACAACCCTAACATTGTGAAG       c.1920
 A  D  F  Q  R  E  A  A  L  M  A  E  F  D  N  P  N  I  V  K         p.640

         | 15.         .         .         .         .         .    g.136588
 CTATTAG | GAGTGTGTGCTGTCGGGAAGCCAATGTGCCTGCTCTTTGAATACATGGCCTAT    c.1980
 L  L  G |   V  C  A  V  G  K  P  M  C  L  L  F  E  Y  M  A  Y      p.660

          .         .         .         .         .         .       g.136648
 GGTGACCTCAATGAGTTCCTCCGCAGCATGTCCCCTCACACCGTGTGCAGCCTCAGTCAC       c.2040
 G  D  L  N  E  F  L  R  S  M  S  P  H  T  V  C  S  L  S  H         p.680

          .         .         .         .         .         .       g.136708
 AGTGACTTGTCTATGAGGGCTCAGGTCTCCAGCCCTGGGCCCCCACCCCTCTCCTGTGCT       c.2100
 S  D  L  S  M  R  A  Q  V  S  S  P  G  P  P  P  L  S  C  A         p.700

          .         .         .         .         .         .       g.136768
 GAGCAGCTTTGCATTGCCAGGCAGGTGGCAGCTGGCATGGCTTACCTCTCAGAACGTAAG       c.2160
 E  Q  L  C  I  A  R  Q  V  A  A  G  M  A  Y  L  S  E  R  K         p.720

          .         .         .         .         .         .       g.136828
 TTTGTTCACCGAGATTTAGCCACCAGGAACTGCCTGGTGGGCGAGAACATGGTGGTGAAA       c.2220
 F  V  H  R  D  L  A  T  R  N  C  L  V  G  E  N  M  V  V  K         p.740

          .         .         .         .         .         .       g.136888
 ATTGCCGACTTTGGCCTCTCCAGGAACATCTACTCAGCAGACTACTACAAAGCTAATGAA       c.2280
 I  A  D  F  G  L  S  R  N  I  Y  S  A  D  Y  Y  K  A  N  E         p.760

          .         .         .         .         .         .       g.136948
 AACGACGCTATCCCTATCCGTTGGATGCCACCAGAGTCCATTTTTTATAACCGCTACACT       c.2340
 N  D  A  I  P  I  R  W  M  P  P  E  S  I  F  Y  N  R  Y  T         p.780

          .         .         .         .         .         .       g.137008
 ACAGAGTCTGATGTGTGGGCCTATGGCGTGGTCCTCTGGGAGATCTTCTCCTATGGCCTG       c.2400
 T  E  S  D  V  W  A  Y  G  V  V  L  W  E  I  F  S  Y  G  L         p.800

          .         .         .         .         .         .       g.137068
 CAGCCCTACTATGGGATGGCCCATGAGGAGGTCATTTACTACGTGCGAGATGGCAACATC       c.2460
 Q  P  Y  Y  G  M  A  H  E  E  V  I  Y  Y  V  R  D  G  N  I         p.820

          .         .         .         .         .         .       g.137128
 CTCTCCTGCCCTGAGAACTGCCCCGTGGAGCTGTACAATCTCATGCGTCTATGTTGGAGC       c.2520
 L  S  C  P  E  N  C  P  V  E  L  Y  N  L  M  R  L  C  W  S         p.840

          .         .         .         .         .         .       g.137188
 AAGCTGCCTGCAGACAGACCCAGTTTCACCAGTATTCACCGAATTCTGGAACGCATGTGT       c.2580
 K  L  P  A  D  R  P  S  F  T  S  I  H  R  I  L  E  R  M  C         p.860

          .         .         .                                     g.137218
 GAGAGGGCAGAGGGAACTGTGAGTGTCTAA                                     c.2610
 E  R  A  E  G  T  V  S  V  X                                       p.869

          .                                                         g.137228
 ggttgaagac                                                         c.*10

 (downstream sequence)
Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The Muscle, skeletal, receptor tyrosine kinase protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.

Powered by LOVD v.3.0 Build 20b
©2004-2017 Leiden University Medical Center