mutY homolog (E. coli) (MUTYH) - coding DNA reference sequence

(used for variant description)

(last modified February 23, 2014)


This file was created to facilitate the description of sequence variants on transcript NM_001128425.1 in the MUTYH gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NC_000001.10, covering MUTYH transcript NM_001128425.1.


Please note that introns are available by clicking on the exon numbers above the sequence.
 (upstream sequence)
                               .         .         .                g.5036
                         cagccggagccgcggtgtacaacggaacttgtagtc       c.-181

 .         .         .         .         .         .                g.5096
 tcctcgtggctagttcaggcggaaggagcagtcctctgaagcttgaggagcctctagaac       c.-121

 .         .         .         .         .         .                g.5156
 tatgagcccgaggccttcccctctcccagagcgcagaggctttgaaggctacctctggga       c.-61

 .         .         .         .         .         .                g.5216
 agccgctcaccgtcggaagctgcgggagctgaaactgcgccatcgtcactgtcggcggcc       c.-1

          .         .         .       | 02 .         .         .    g.10983
 ATGACACCGCTCGTCTCCCGCCTGAGTCGTCTGTGG | GCCATCATGAGGAAGCCACGAGCA    c.60
 M  T  P  L  V  S  R  L  S  R  L  W   | A  I  M  R  K  P  R  A      p.20

          .         .         .         .         .         .       g.11043
 GCCGTGGGAAGTGGTCACAGGAAGCAGGCAGCCAGCCAGGAAGGGAGGCAGAAGCATGCT       c.120
 A  V  G  S  G  H  R  K  Q  A  A  S  Q  E  G  R  Q  K  H  A         p.40

          .         .         .        | 03.         .         .    g.11890
 AAGAACAACAGTCAGGCCAAGCCTTCTGCCTGTGATG | CCTGTGCAGGGATGATTGCTGAG    c.180
 K  N  N  S  Q  A  K  P  S  A  C  D  A |   C  A  G  M  I  A  E      p.60

          .         .         .         .         .         .       g.11950
 TGTCCTGGGGCCCCAGCAGGCCTGGCCAGGCAGCCGGAAGAGGTGGTATTGCAGGCCTCT       c.240
 C  P  G  A  P  A  G  L  A  R  Q  P  E  E  V  V  L  Q  A  S         p.80

          .         .         .         .         .         .       g.12010
 GTCTCCTCATACCATCTATTCAGAGACGTAGCTGAAGTCACAGCCTTCCGAGGGAGCCTG       c.300
 V  S  S  Y  H  L  F  R  D  V  A  E  V  T  A  F  R  G  S  L         p.100

          .         .         .         .         | 04         .    g.12158
 CTAAGCTGGTACGACCAAGAGAAACGGGACCTACCATGGAGAAGACGG | GCAGAAGATGAG    c.360
 L  S  W  Y  D  Q  E  K  R  D  L  P  W  R  R  R   | A  E  D  E      p.120

          .         .         | 05         .         .         .    g.12332
 ATGGACCTGGACAGGCGGGCATATGCTG | TGTGGGTCTCAGAGGTCATGCTGCAGCAGACC    c.420
 M  D  L  D  R  R  A  Y  A  V |   W  V  S  E  V  M  L  Q  Q  T      p.140

          .         .         .         .   | 06     .         .    g.12529
 CAGGTTGCCACTGTGATCAACTACTATACCGGATGGATGCAG | AAGTGGCCTACACTGCAG    c.480
 Q  V  A  T  V  I  N  Y  Y  T  G  W  M  Q   | K  W  P  T  L  Q      p.160

          .         .     | 07   .         .         .         .    g.12672
 GACCTGGCCAGTGCTTCCCTGGAG | GAGGTGAATCAACTCTGGGCTGGCCTGGGCTACTAT    c.540
 D  L  A  S  A  S  L  E   | E  V  N  Q  L  W  A  G  L  G  Y  Y      p.180

          .         .         .       | 08 .         .         .    g.12807
 TCTCGTGGCCGGCGGCTGCAGGAGGGAGCTCGGAAG | GTGGTAGAGGAGCTAGGGGGCCAC    c.600
 S  R  G  R  R  L  Q  E  G  A  R  K   | V  V  E  E  L  G  G  H      p.200

          .         .         .         .         .         .       g.12867
 ATGCCACGTACAGCAGAGACCCTGCAGCAGCTCCTGCCTGGCGTGGGGCGCTACACAGCT       c.660
 M  P  R  T  A  E  T  L  Q  Q  L  L  P  G  V  G  R  Y  T  A         p.220

          .         .         . | 09       .         .         .    g.13012
 GGGGCCATTGCCTCTATCGCCTTTGGCCAG | GCAACCGGTGTGGTGGATGGCAACGTAGCA    c.720
 G  A  I  A  S  I  A  F  G  Q   | A  T  G  V  V  D  G  N  V  A      p.240

          .         .         .         .         .         .       g.13072
 CGGGTGCTGTGCCGTGTCCGAGCCATTGGTGCTGATCCCAGCAGCACCCTTGTTTCCCAG       c.780
 R  V  L  C  R  V  R  A  I  G  A  D  P  S  S  T  L  V  S  Q         p.260

          | 10         .         .         .         .         .    g.13212
 CAGCTCTG | GGGTCTAGCCCAGCAGCTGGTGGACCCAGCCCGGCCAGGAGATTTCAACCAA    c.840
 Q  L  W  |  G  L  A  Q  Q  L  V  D  P  A  R  P  G  D  F  N  Q      p.280

          .         .         .         .         .         .       g.13272
 GCAGCCATGGAGCTAGGGGCCACAGTGTGTACCCCACAGCGCCCACTGTGCAGCCAGTGC       c.900
 A  A  M  E  L  G  A  T  V  C  T  P  Q  R  P  L  C  S  Q  C         p.300

          .         .         .    | 11    .         .         .    g.13411
 CCTGTGGAGAGCCTGTGCCGGGCACGCCAGAGA | GTGGAGCAGGAACAGCTCTTAGCCTCA    c.960
 P  V  E  S  L  C  R  A  R  Q  R   | V  E  Q  E  Q  L  L  A  S      p.320

          .         .         .        | 12.         .         .    g.13644
 GGGAGCCTGTCGGGCAGTCCTGACGTGGAGGAGTGTG | CTCCCAACACTGGACAGTGCCAC    c.1020
 G  S  L  S  G  S  P  D  V  E  E  C  A |   P  N  T  G  Q  C  H      p.340

          .         .         .         .         .         .       g.13704
 CTGTGCCTGCCTCCCTCGGAGCCCTGGGACCAGACCCTGGGAGTGGTCAACTTCCCCAGA       c.1080
 L  C  L  P  P  S  E  P  W  D  Q  T  L  G  V  V  N  F  P  R         p.360

          .         .         .         .         .         .       g.13764
 AAGGCCAGCCGCAAGCCCCCCAGGGAGGAGAGCTCTGCCACCTGTGTTCTGGAACAGCCT       c.1140
 K  A  S  R  K  P  P  R  E  E  S  S  A  T  C  V  L  E  Q  P         p.380

          .         .         .         .       | 13 .         .    g.13928
 GGGGCCCTTGGGGCCCAAATTCTGCTGGTGCAGAGGCCCAACTCAG | GTCTGCTGGCAGGA    c.1200
 G  A  L  G  A  Q  I  L  L  V  Q  R  P  N  S  G |   L  L  A  G      p.400

          .         .         .         .         .         .       g.13988
 CTGTGGGAGTTCCCGTCCGTGACCTGGGAGCCCTCAGAGCAGCTTCAGCGCAAGGCCCTG       c.1260
 L  W  E  F  P  S  V  T  W  E  P  S  E  Q  L  Q  R  K  A  L         p.420

          .         .         .         .         .         .       g.14048
 CTGCAGGAACTACAGCGTTGGGCTGGGCCCCTCCCAGCCACGCACCTCCGGCACCTTGGG       c.1320
 L  Q  E  L  Q  R  W  A  G  P  L  P  A  T  H  L  R  H  L  G         p.440

     | 14    .         .         .         .         .         .    g.14193
 GAG | GTTGTCCACACCTTCTCTCACATCAAGCTGACATATCAAGTATATGGGCTGGCCTTG    c.1380
 E   | V  V  H  T  F  S  H  I  K  L  T  Y  Q  V  Y  G  L  A  L      p.460

          .         .         .         .         .         .       g.14253
 GAAGGGCAGACCCCAGTGACCACCGTACCACCAGGTGCTCGCTGGCTGACGCAGGAGGAA       c.1440
 E  G  Q  T  P  V  T  T  V  P  P  G  A  R  W  L  T  Q  E  E         p.480

          .         .         .       | 15 .         .         .    g.14937
 TTTCACACCGCAGCTGTTTCCACCGCCATGAAAAAG | GTTTTCCGTGTGTATCAGGGCCAA    c.1500
 F  H  T  A  A  V  S  T  A  M  K  K   | V  F  R  V  Y  Q  G  Q      p.500

          .         | 16         .         .         .         .    g.16075
 CAGCCAGGGACCTGTATG | GGTTCCAAAAGGTCCCAGGTGTCCTCTCCGTGCAGTCGGAAA    c.1560
 Q  P  G  T  C  M   | G  S  K  R  S  Q  V  S  S  P  C  S  R  K      p.520

          .         .         .         .         .         .       g.16135
 AAGCCCCGCATGGGCCAGCAAGTCCTGGATAATTTCTTTCGGTCTCACATCTCCACTGAT       c.1620
 K  P  R  M  G  Q  Q  V  L  D  N  F  F  R  S  H  I  S  T  D         p.540

          .         .         .                                     g.16165
 GCACACAGCCTCAACAGTGCAGCCCAGTGA                                     c.1650
 A  H  S  L  N  S  A  A  Q  X                                       p.549

          .         .         .         .         .         .       g.16225
 cacctctgaaagcccccattccctgagaatcctgttgttagtaaagtgcttatttttgta       c.*60

                                                                    g.16229
 gtta                                                               c.*64

 (downstream sequence)
Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The MutY homolog (E. coli) protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.

Powered by LOVD v.3.0 Build 09
©2004-2014 Leiden University Medical Center