(intronic numbering for coding DNA Reference Sequence)
. . . . . . g.25093
gtgagcagctcccctgctcattcctgaagggagcacaggctggggctcagcaagcaaggc c.5157+60
g.25094
t c.5157+61
--------------------- middle of intron ---------------------
g.25095 g.25095
c.5158-61 t c.5158-61
. . . . . . g.25155
gagagctatgcatagatgctcaatgcttttcctgctctgcccaaccctcccccaacccag c.5158-1
Powered by LOVD v.3.0 Build 14
©2004-2015 Leiden University Medical Center