myosin, light chain 2, regulatory, cardiac, slow (MYL2) - coding DNA reference sequence

(used for variant description)

(last modified December 27, 2018)


This file was created to facilitate the description of sequence variants on transcript NM_000432.3 in the MYL2 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_007554.1, covering MYL2 transcript NM_000432.3.


Please note that introns are available by clicking on the exon numbers above the sequence.
 (upstream sequence)
                                                   .                g.4988
                                                  gttcctgggct       c.-61

 .         .         .         .         .         .                g.5048
 gcagagagctgggcggagtgtggaattcttctcgggaggcagtgctgggtcctttccacc       c.-1

     | 02    .         .         .         .         .         .    g.6441
 ATG | GCACCTAAGAAAGCAAAGAAGAGAGCCGGGGGCGCCAACTCCAACGTGTTCTCCATG    c.60
 M   | A  P  K  K  A  K  K  R  A  G  G  A  N  S  N  V  F  S  M      p.20

          .         .         .    | 03    .         .         .    g.9814
 TTCGAACAGACCCAAATCCAGGAATTTAAGGAG | GCCTTCACTATCATGGACCAGAACAGG    c.120
 F  E  Q  T  Q  I  Q  E  F  K  E   | A  F  T  I  M  D  Q  N  R      p.40

          .         .         .         .          | 04        .    g.11298
 GATGGCTTCATTGACAAGAACGATCTGAGAGACACCTTTGCTGCCCTTG | GGCGAGTGAAC    c.180
 D  G  F  I  D  K  N  D  L  R  D  T  F  A  A  L  G |   R  V  N      p.60

          .         .         .         .         .         .       g.11358
 GTGAAAAATGAAGAAATTGATGAAATGATCAAGGAGGCTCCGGGTCCAATTAACTTTACT       c.240
 V  K  N  E  E  I  D  E  M  I  K  E  A  P  G  P  I  N  F  T         p.80

          .         .         .     | 05   .         .         .    g.12279
 GTGTTCCTCACAATGTTTGGGGAGAAACTTAAGG | GAGCGGACCCTGAGGAAACCATTCTC    c.300
 V  F  L  T  M  F  G  E  K  L  K  G |   A  D  P  E  E  T  I  L      p.100

          .         .         .         .         .    | 06    .    g.12440
 AACGCATTCAAAGTGTTTGACCCTGAAGGCAAAGGGGTGCTGAAGGCTGATTA | CGTTCGG    c.360
 N  A  F  K  V  F  D  P  E  G  K  G  V  L  K  A  D  Y  |  V  R      p.120

          .         .         .         .   | 07     .         .    g.14420
 GAAATGCTGACCACGCAGGCGGAGAGGTTTTCCAAGGAGGAG | GTTGACCAGATGTTCGCC    c.420
 E  M  L  T  T  Q  A  E  R  F  S  K  E  E   | V  D  Q  M  F  A      p.140

          .         .         .         .         .         .       g.14480
 GCCTTCCCCCCTGACGTGACTGGCAACTTGGACTACAAGAACCTGGTGCACATCATCACC       c.480
 A  F  P  P  D  V  T  G  N  L  D  Y  K  N  L  V  H  I  I  T         p.160

          .         .                                               g.14501
 CACGGAGAAGAGAAGGACTAG                                              c.501
 H  G  E  E  K  D  X                                                p.166

          .         .         .         .         .         .       g.14561
 gagggggctcgctgctgcgccctgggctcgtctttgcagagtggtccctgccctcatctc       c.*60

          .         .         .         .         .         .       g.14621
 tctcccccgagtaccgcctctgtccctaccttgtctgttagccatgtggctgccccattt       c.*120

          .         .         .         .         .         .       g.14681
 atccacctccatcttctttgcagcctgggtggctatgggtacttcgtggccgcacatcct       c.*180

          .         .         .         .         .         .       g.14741
 acagttggaaatccatccagaggccatgttccaataaacaggaggtcgtgtatttggtca       c.*240

          .                                                         g.14759
 cgacatttctctgacaaa                                                 c.*258

 (downstream sequence)
Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The Myosin, light chain 2, regulatory, cardiac, slow protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.

Powered by LOVD v.3.0 Build 21
©2004-2018 Leiden University Medical Center