myosin light chain, phosphorylatable, fast skeletal muscle (MYLPF) - coding DNA reference sequence

(used for variant description)

(last modified July 27, 2020)


This file was created to facilitate the description of sequence variants on transcript NM_013292.3 in the MYLPF gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_050592.1, covering MYLPF transcript NM_013292.3.


Please note that introns are available by clicking on the exon numbers above the sequence.
 (upstream sequence)
           .         .         .         .         .                g.5056
     gactccttgcttctttccagccggagccgctgccttgccccccggagactgaagac       c.-1

     | 02    .         .         .         .         .         .    g.6075
 ATG | GCACCCAAGAGGGCCAAGAGAAGGACAGTAGAGGGCGGAAGCTCCAGCGTCTTCTCC    c.60
 M   | A  P  K  R  A  K  R  R  T  V  E  G  G  S  S  S  V  F  S      p.20

          .         .         .       | 03 .         .         .    g.6367
 ATGTTCGACCAGACTCAGATCCAGGAGTTCAAAGAG | GCCTTCACTGTGATCGACCAGAAC    c.120
 M  F  D  Q  T  Q  I  Q  E  F  K  E   | A  F  T  V  I  D  Q  N      p.40

          .         .         .         .         .   | 04     .    g.6629
 CGTGATGGTATTATAGACAAGGAGGACCTTCGGGACACCTTCGCAGCCATGG | GCCGCCTC    c.180
 R  D  G  I  I  D  K  E  D  L  R  D  T  F  A  A  M  G |   R  L      p.60

          .         .         .         .         .         .       g.6689
 AATGTGAAGAATGAGGAGTTGGATGCCATGATGAAGGAAGCCAGCGGTCCCATCAACTTC       c.240
 N  V  K  N  E  E  L  D  A  M  M  K  E  A  S  G  P  I  N  F         p.80

          .         .         .        | 05.         .         .    g.6841
 ACCGTCTTCCTGACCATGTTCGGGGAGAAGCTCAAGG | GTGCCGACCCTGAGGATGTGATC    c.300
 T  V  F  L  T  M  F  G  E  K  L  K  G |   A  D  P  E  D  V  I      p.100

          .         .         .         .         .       | 06 .    g.7856
 ACCGGAGCCTTCAAGGTCTTGGACCCTGAGGGAAAGGGCACCATCAAGAAGAAGTT | CCTG    c.360
 T  G  A  F  K  V  L  D  P  E  G  K  G  T  I  K  K  K  F  |  L      p.120

          .         .         .         .      | 07  .         .    g.8009
 GAGGAGCTGCTGACCACGCAGTGTGACCGCTTCTCCCAGGAGGAG | ATCAAGAACATGTGG    c.420
 E  E  L  L  T  T  Q  C  D  R  F  S  Q  E  E   | I  K  N  M  W      p.140

          .         .         .         .         .         .       g.8069
 GCGGCCTTCCCCCCCGACGTGGGCGGCAACGTCGACTACAAAAACATCTGCTACGTCATC       c.480
 A  A  F  P  P  D  V  G  G  N  V  D  Y  K  N  I  C  Y  V  I         p.160

          .         .         .                                     g.8099
 ACGCACGGCGACGCCAAGGACCAGGAGTAG                                     c.510
 T  H  G  D  A  K  D  Q  E  X                                       p.169

          .         .         .         .         .         .       g.8159
 gggcacccgcgggcctccgctgcccgacgcttctgttcggcccgacctccaccccggctc       c.*60

          .         .                                               g.8188
 ccaataaaatttaactgatctttgtttct                                      c.*89

 (downstream sequence)
Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The Myosin light chain, phosphorylatable, fast skeletal muscle protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.

Powered by LOVD v.3.0 Build 24
©2004-2020 Leiden University Medical Center