Norrie disease (pseudoglioma) (NDP) - coding DNA reference sequence

(used for variant description)

(last modified November 25, 2020)

This file was created to facilitate the description of sequence variants on transcript NM_000266.3 in the NDP gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_009832.1, covering NDP transcript NM_000266.3.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
                               .         .         .                g.5039
                      aagatgctccgtggaagggagccgagcggtgggcagagg       c.-541

 .         .         .         .         .         .                g.5099
 ctgagtccccgataacgagcgcctcacatttccgtggcattcccatttgctagtgcgctg       c.-481

 .         .         .         .         .         .                g.5159
 ctgcggccgcacgcctgattgatatatgactgcaatggcacttttccatttgacattctc       c.-421

 .         .         .         .         .         .                g.5219
 tctctctctctccctctctctctctccctctctctctccctctctctctctccctgtgtc       c.-361

 .         .         .         .         .         .                g.5279
 gcttaaacaacagtcctaacttttgtgtgttgcaaatataaaaggcaagccatgtgacag       c.-301

 .         .         .         .         .         .                g.5339
 agggacagaagaacaaaagcatttggaagtaacaggacctctttctagctctcagaaaag       c.-241

 .         .         .         .   | 02     .         .             g.19850
 tctgagaagaaaggagccctgcgttcccctaag | ctgtgcagcagatactgtgatgatgga    c.-181

 .         .         .         .         .         .                g.19910
 ttgcaagtgcaaagagtaagacaaaactccagcacataaaggacaatgacaaccagaaag       c.-121

 .         .         .         .         .         .                g.19970
 cttcagcccgatcctgccctttccttgaacgggactggatcctaggaggtgaagccattt       c.-61

 .         .         .         .         .         .                g.20030
 ccaattttttgtcctctgcctccctctgctgttcttctagagaagtttttccttacaaca       c.-1

          .         .         .         .         .         .       g.20090
 ATGAGAAAACATGTACTAGCTGCATCCTTTTCTATGCTCTCCCTGCTGGTGATAATGGGA       c.60
 M  R  K  H  V  L  A  A  S  F  S  M  L  S  L  L  V  I  M  G         p.20

          .         .         .         .         .         .       g.20150
 GATACAGACAGTAAAACGGACAGCTCATTCATAATGGACTCGGACCCTCGACGCTGCATG       c.120
 D  T  D  S  K  T  D  S  S  F  I  M  D  S  D  P  R  R  C  M         p.40

          .         .         .         .         .     | 03   .    g.28655
 AGGCACCACTATGTGGATTCTATCAGTCACCCATTGTACAAGTGTAGCTCAAAG | ATGGTG    c.180
 R  H  H  Y  V  D  S  I  S  H  P  L  Y  K  C  S  S  K   | M  V      p.60

          .         .         .         .         .         .       g.28715
 CTCCTGGCCAGGTGCGAGGGGCACTGCAGCCAGGCGTCACGCTCCGAGCCTTTGGTGTCG       c.240
 L  L  A  R  C  E  G  H  C  S  Q  A  S  R  S  E  P  L  V  S         p.80

          .         .         .         .         .         .       g.28775
 TTCAGCACTGTCCTCAAGCAACCCTTCCGTTCCTCCTGTCACTGCTGCCGGCCCCAGACT       c.300
 F  S  T  V  L  K  Q  P  F  R  S  S  C  H  C  C  R  P  Q  T         p.100

          .         .         .         .         .         .       g.28835
 TCCAAGCTGAAGGCACTGCGGCTGCGATGCTCAGGGGGCATGCGACTCACTGCCACCTAC       c.360
 S  K  L  K  A  L  R  L  R  C  S  G  G  M  R  L  T  A  T  Y         p.120

          .         .         .         .                           g.28877
 CGGTACATCCTCTCCTGTCACTGCGAGGAATGCAATTCCTGA                         c.402
 R  Y  I  L  S  C  H  C  E  E  C  N  S  X                           p.133

          .         .         .         .         .         .       g.28937
 ggcccgctgctgtgtgtggcttctggatgggacaactgtagaggcagttcgaccagccag       c.*60

          .         .         .         .         .         .       g.28997
 ggaaagactggcaagaaaagagttaaggcaaaaaaggatgcaacaattctcccgggactc       c.*120

          .         .         .         .         .         .       g.29057
 tgcatattctagtaataaagactctacatgcttgttgacagagagagatactctgggaac       c.*180

          .         .         .         .         .         .       g.29117
 ttctttgcagttcccatctcctttctctggtacaatttcttttggttcattttcagattc       c.*240

          .         .         .         .         .         .       g.29177
 aggcattttcccccttggctctcaatgctgtttgggtttccaacaattcagcattagtgg       c.*300

          .         .         .         .         .         .       g.29237
 gaaaaagtgggccctcatacacaagcgtgtcaggctgtcagtgtttggtgcacgctgggg       c.*360

          .         .         .         .         .         .       g.29297
 aagaatttactttggaaagtagaaaagcccagcttttcctgggacatcttctgttattgt       c.*420

          .         .         .         .         .         .       g.29357
 tgatgtttttttttaccttgtcattttggtctaaggttgccattgctgctaaaggttacc       c.*480

          .         .         .         .         .         .       g.29417
 gatttcaaagtccagataccaagcatgtggatatgtttagctacgtttactcacagccag       c.*540

          .         .         .         .         .         .       g.29477
 cgaactgacattaaaataactaacaaacagattcttttatgtgatgctggaactcttgac       c.*600

          .         .         .         .         .         .       g.29537
 agctataattattattcagaaatgactttttgaaagtaaaagcagcataaagaatttgtc       c.*660

          .         .         .         .         .         .       g.29597
 acaggaaggctgtctcagataaattatggtaaaattttgtaagggagcagacttttaaag       c.*720

          .         .         .         .         .         .       g.29657
 acttgcacaaatacggatcctgcactgactctggaaaaggcatatatgtactagtggcat       c.*780

          .         .         .         .         .         .       g.29717
 ggagaatgcaccatactcatgcatgcaaattagacaaccaagtatgaatctatttgtggg       c.*840

          .         .         .         .         .         .       g.29777
 tgtgctatagctttagccgtgtcacgggcatcattctctaatatccacttgtccatgtga       c.*900

          .         .         .         .         .         .       g.29837
 aacatgttgccaaaatggtggcctggcttgtcttctgaacgtttggttcaaatgtgtttt       c.*960

          .         .         .         .         .         .       g.29897
 ggtcctggaggctcaaattttgagttattcccacgttttgaaataaaaagagtatattca       c.*1020

                                                                    g.29900
 aaa                                                                c.*1023

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The Norrie disease (pseudoglioma) protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.