NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 1, 7.5kDa (NDUFA1) - coding DNA reference sequence

(used for variant description)

(last modified June 12, 2016)

This file was created to facilitate the description of sequence variants on transcript NM_004541.3 in the NDUFA1 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_009381.1, covering NDUFA1 transcript NM_004541.3.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
                                         .         .                g.5021
                                        agattccgtcgcttcttccgg       c.-121

 .         .         .         .         .         .                g.5081
 agccgtacgtggcaccgccccgctcgcgggcggccgcggggcttgctgggaagagaggcg       c.-61

 .         .         .         .         .         .                g.5141
 aagccaggtcacctttcaaggacccagaagtagggttttggcctaggtaacggggcagag       c.-1

          .         .         .         .         .         .       g.5201
 ATGTGGTTCGAGATTCTCCCCGGACTCTCCGTCATGGGCGTGTGCTTGTTGATTCCAGGA       c.60
 M  W  F  E  I  L  P  G  L  S  V  M  G  V  C  L  L  I  P  G         p.20

          .         .         .         .   | 02     .         .    g.6551
 CTGGCTACTGCGTACATCCACAGGTTCACTAACGGGGGCAAG | GAAAAAAGGGTTGCTCAT    c.120
 L  A  T  A  Y  I  H  R  F  T  N  G  G  K   | E  K  R  V  A  H      p.40

          .         .         .         .         .         .       g.6611
 TTTGGGTATCACTGGAGTCTGATGGAAAGAGATAGGCGCATCTCTGGAGTTGATCGTTAC       c.180
 F  G  Y  H  W  S  L  M  E  R  D  R  R  I  S  G  V  D  R  Y         p.60

          .   | 03     .         .                                  g.9791
 TATGTGTCAAAG | GGTTTGGAGAACATTGATTAA                               c.213
 Y  V  S  K   | G  L  E  N  I  D  X                                 p.70

          .         .         .         .         .         .       g.9851
 ggaagcattttcctgattgatgaaaaaaataactcagttatggccatctacccctgctag       c.*60

          .         .         .         .         .         .       g.9911
 aaggttacagtgtattatgtagcatgcaatgtgttatgtagtgcttaataaaaataaaat       c.*120

          .                                                         g.9923
 gaaaaaaatgca                                                       c.*132

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 1, 7.5kDa protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.