NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 10, 22kDa (NDUFB10) - coding DNA reference sequence

(used for variant description)

(last modified September 16, 2016)


This file was created to facilitate the description of sequence variants on transcript NM_004548.2 in the NDUFB10 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NC_000016.9, covering NDUFB10 transcript NM_004548.2.


Please note that introns are available by clicking on the exon numbers above the sequence.
 (upstream sequence)
                     .         .         .         .                g.5049
            gcagccgccctcggcgtcctctgtagcgggcgacctaggccgcgggacc       c.-61

 .         .         .         .         .         .                g.5109
 cggacggaggtagaggccagggcagcgcgtccgggagcggagtccgcgcccgccgccgcc       c.-1

          .         .         .         .         .         .       g.5169
 ATGCCGGACAGCTGGGACAAGGATGTGTACCCTGAGCCCCCGCGCCGCACGCCGGTGCAG       c.60
 M  P  D  S  W  D  K  D  V  Y  P  E  P  P  R  R  T  P  V  Q         p.20

          .         .         .         .         .         .       g.5229
 CCCAATCCCATCGTCTACATGATGAAAGCGTTCGACCTCATCGTGGACCGACCCGTGACC       c.120
 P  N  P  I  V  Y  M  M  K  A  F  D  L  I  V  D  R  P  V  T         p.40

          . | 02       .         .         .         .         .    g.6687
 CTCGTGAGAG | AATTTATAGAGCGGCAGCACGCAAAGAACAGGTATTACTACTACCACCGG    c.180
 L  V  R  E |   F  I  E  R  Q  H  A  K  N  R  Y  Y  Y  Y  H  R      p.60

          .         .         .         .         .         .       g.6747
 CAGTACCGCCGCGTGCCAGACATCACTGAGTGCAAGGAGGAGGACATCATGTGCATGTAT       c.240
 Q  Y  R  R  V  P  D  I  T  E  C  K  E  E  D  I  M  C  M  Y         p.80

          .         .          | 03        .         .         .    g.7012
 GAAGCCGAAATGCAGTGGAAGAGGGACTA | CAAAGTCGACCAAGAAATTATCAACATTATG    c.300
 E  A  E  M  Q  W  K  R  D  Y  |  K  V  D  Q  E  I  I  N  I  M      p.100

          .         .         .         .         .         .       g.7072
 CAGGATCGGCTCAAAGCCTGTCAGCAGAGGGAAGGACAGAACTACCAGCAGAACTGTATC       c.360
 Q  D  R  L  K  A  C  Q  Q  R  E  G  Q  N  Y  Q  Q  N  C  I         p.120

          .         .         .         .          | 04        .    g.7292
 AAGGAAGTGGAGCAGTTCACCCAGGTGGCCAAGGCCTACCAGGACCGCT | ATCAGGACCTG    c.420
 K  E  V  E  Q  F  T  Q  V  A  K  A  Y  Q  D  R  Y |   Q  D  L      p.140

          .         .         .         .         .         .       g.7352
 GGGGCCTACAGTTCTGCCAGGAAGTGCCTGGCCAAACAGAGGCAGAGGATGCTGCAAGAG       c.480
 G  A  Y  S  S  A  R  K  C  L  A  K  Q  R  Q  R  M  L  Q  E         p.160

          .         .         .                                     g.7391
 AGAAAAGCTGCAAAAGAGGCCGCCGCTGCCACCTCCTGA                            c.519
 R  K  A  A  K  E  A  A  A  A  T  S  X                              p.172

          .         .         .         .         .         .       g.7451
 ggcagctgtgggtgcccctgctgtgtggctctgtatgactgttgctgaaatataaagccc       c.*60

                                                                    g.7460
 tgcaacctg                                                          c.*69

 (downstream sequence)
Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 10, 22kDa protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.

Powered by LOVD v.3.0 Build 16
©2004-2016 Leiden University Medical Center