NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 11, 17.3kDa (NDUFB11) - coding DNA reference sequence

(used for variant description)

(last modified April 9, 2019)

This file was created to facilitate the description of sequence variants on transcript NM_019056.6 in the NDUFB11 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_052579.1, covering NDUFB11 transcript NM_019056.6.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
           .         .         .         .         .                g.5051
          gctctggccggccccggcgattggtcaccgcccgctaggggacagccctgg       c.-481

 .         .         .         .         .         .                g.5111
 cctcctctgattggcaagcgctggccacctccccacaccccttgcgaacgctcccctagt       c.-421

 .         .         .         .         .         .                g.5171
 ggagaaaaggagtagctattagccaattcggcagggcccgctttttagaagcttgatttc       c.-361

 .         .         .         .         .         .                g.5231
 ctttgaagatgaaagactagcggaagctctgcctctttccccagtgggcgagggaactcg       c.-301

 .         .         .         .         .         .                g.5291
 gggcgattggctgggaactgtatccacccaaatgtcaccgatttcttcctatgcaggaaa       c.-241

 .         .         .         .         .         .                g.5351
 tgagcagacccatcaataagaaatttctcagcctggccgaaaatggttggccccacgaag       c.-181

 .         .         .         .         .         .                g.5411
 ccacgacaactggaggcaaagagggttgctcaacgccccgcctcattggaaaaccaaatc       c.-121

 .         .         .         .         .         .                g.5471
 agatctgggacctatatagcgtggcggaggcggggcgatgattgtcgcgctcgcacccac       c.-61

 .         .         .         .         .         .                g.5531
 tgcagctgcgcacagtcgcatttctttccccgcccctgagaccctgcagcaccatctgtc       c.-1

          .         .         .         .         .         .       g.5591
 ATGGCGGCTGGGCTGTTTGGTTTGAGCGCTCGCCGTCTTTTGGCGGCAGCGGCGACGCGA       c.60
 M  A  A  G  L  F  G  L  S  A  R  R  L  L  A  A  A  A  T  R         p.20

          .         .         .         .         .         .       g.5651
 GGGCTCCCGGCCGCCCGCGTCCGCTGGGAATCTAGCTTCTCCAGGACTGTGGTCGCCCCG       c.120
 G  L  P  A  A  R  V  R  W  E  S  S  F  S  R  T  V  V  A  P         p.40

          .         .         .         .         .         .       g.5711
 TCCGCTGTGGCGGGAAAGCGGCCCCCAGAACCGACCACACCGTGGCAAGAGGACCCAGAA       c.180
 S  A  V  A  G  K  R  P  P  E  P  T  T  P  W  Q  E  D  P  E         p.60

          .         .        | 02.         .         .         .    g.7499
 CCCGAGGACGAAAACTTGTATGAGAAG | AACCCAGACTCCCATGGTTATGACAAGGACCCC    c.240
 P  E  D  E  N  L  Y  E  K   | N  P  D  S  H  G  Y  D  K  D  P      p.80

          .         .         .         .         .         .       g.7559
 GTTTTGGACGTCTGGAACATGCGACTTGTCTTCTTCTTTGGCGTCTCCATCATCCTGGTC       c.300
 V  L  D  V  W  N  M  R  L  V  F  F  F  G  V  S  I  I  L  V         p.100

          .         .         .         .         .         .       g.7619
 CTTGGCAGCACCTTTGTGGCCTATCTGCCTGACTACAGGTGCACAGGGTGTCCAAGAGCG       c.360
 L  G  S  T  F  V  A  Y  L  P  D  Y  R  C  T  G  C  P  R  A         p.120

          | 03         .         .         .         .         .    g.7822
 TGGGATGG | GATGAAAGAGTGGTCCCGCCGCGAAGCTGAGAGGCTTGTGAAATACCGAGAG    c.420
 W  D  G  |  M  K  E  W  S  R  R  E  A  E  R  L  V  K  Y  R  E      p.140

          .         .         .         .         .         .       g.7882
 GCCAATGGCCTTCCCATCATGGAATCCAACTGCTTCGACCCCAGCAAGATCCAGCTGCCA       c.480
 A  N  G  L  P  I  M  E  S  N  C  F  D  P  S  K  I  Q  L  P         p.160

          .                                                         g.7894
 GAGGATGAGTGA                                                       c.492
 E  D  E  X                                                         p.163

          .         .         .         .         .         .       g.7954
 ccagttgctaagtggggctcaagaagcaccgccttccccaccccctgcctgccattctga       c.*60

          .         .         .         .                           g.7995
 cctcttctcagagcacctaattaaaggggctgaaagtctga                          c.*101

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 11, 17.3kDa protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.