NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 9, 22kDa (NDUFB9) - coding DNA reference sequence

(used for variant description)

(last modified May 4, 2026)

This file was created to facilitate the description of sequence variants on transcript NM_005005.2 in the NDUFB9 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NC_000008.10, covering NDUFB9 transcript NM_005005.2.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
                                         .         .                g.5025
                                    cccttccggctggccccgctcagtc       c.-61

 .         .         .         .         .         .                g.5085
 acccgcagcaggcgtgcagtttcccggctctccgcgcggccggggaaggtcagcgccgta       c.-1

          .         .         .         .         .         .       g.5145
 ATGGCGTTCTTGGCGTCGGGACCCTACCTGACCCATCAGCAAAAGGTGTTGCGGCTTTAT       c.60
 M  A  F  L  A  S  G  P  Y  L  T  H  Q  Q  K  V  L  R  L  Y         p.20

          .         .         .         .  | 02      .         .    g.9004
 AAGCGGGCGCTACGCCACCTCGAGTCGTGGTGCGTCCAGAG | AGACAAATACCGATACTTT    c.120
 K  R  A  L  R  H  L  E  S  W  C  V  Q  R  |  D  K  Y  R  Y  F      p.40

          .         .         .         .         .         .       g.9064
 GCTTGTTTGATGAGAGCCCGGTTTGAAGAACATAAGAATGAAAAGGATATGGCGAAGGCC       c.180
 A  C  L  M  R  A  R  F  E  E  H  K  N  E  K  D  M  A  K  A         p.60

          .         .         .         .         .         .       g.9124
 ACCCAGCTGCTGAAGGAGGCCGAGGAAGAATTCTGGTACCGTCAGCATCCACAGCCATAC       c.240
 T  Q  L  L  K  E  A  E  E  E  F  W  Y  R  Q  H  P  Q  P  Y         p.80

          .         .         .         .         .     | 03   .    g.12904
 ATCTTCCCTGACTCTCCTGGGGGCACCTCCTATGAGAGATACGATTGCTACAAG | GTCCCA    c.300
 I  F  P  D  S  P  G  G  T  S  Y  E  R  Y  D  C  Y  K   | V  P      p.100

          .         .         .         .         .         .       g.12964
 GAATGGTGCTTAGATGACTGGCATCCTTCTGAGAAGGCAATGTATCCTGATTACTTTGCC       c.360
 E  W  C  L  D  D  W  H  P  S  E  K  A  M  Y  P  D  Y  F  A         p.120

          .         .         .         .         | 04         .    g.15671
 AAGAGAGAACAGTGGAAGAAACTGCGGAGGGAAAGCTGGGAACGAGAG | GTTAAGCAGCTG    c.420
 K  R  E  Q  W  K  K  L  R  R  E  S  W  E  R  E   | V  K  Q  L      p.140

          .         .         .         .         .         .       g.15731
 CAGGAGGAAACGCCACCTGGTGGTCCTTTAACTGAAGCTTTGCCCCCTGCCCGAAAGGAA       c.480
 Q  E  E  T  P  P  G  G  P  L  T  E  A  L  P  P  A  R  K  E         p.160

          .         .         .         .         .         .       g.15791
 GGTGATTTGCCCCCACTGTGGTGGTATATTGTGACCAGACCCCGGGAGCGGCCCATGTAG       c.540
 G  D  L  P  P  L  W  W  Y  I  V  T  R  P  R  E  R  P  M  X         p.179

          .         .         .         .         .         .       g.15851
 aaagagagagacctcatctttcatgcttgcaagtgaaatatgttacagaacatgcacttg       c.*60

          .         .         .                                     g.15885
 ccctaataaaaaatcagtgaaatggtctctggta                                 c.*94

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 9, 22kDa protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.